%PDF-1.5 % 1 0 obj <>/PageLabels 269 0 R>> endobj 2 0 obj <> endobj 3 0 obj <>/Font<>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/Annots[ 55 0 R 60 0 R 61 0 R] /MediaBox[ 0 0 595.56 841.68] /Contents 4 0 R/Group<>/Tabs/S/StructParents 0>> endobj 4 0 obj <> stream x}ێ%7r{@x'(Txg~hA{4kI^= #%/Ւ,ud2G<>~_.zw?'E,2B]~;k%ww,{"/^o/_/Hm/e^p,)_߾weUt!>mm.UX- p2u ~QixAƏ4Ÿ8<#Ys7a +]OKMߥ77Yg]H#! %X`@88LBҩ= ]T8.~-ޗ(>b][[ZK-\A/})08{| ~(׸S{\~nbt"\>x{\5߼wq|ng"XQ"vaܝNǷo EG!\;!(|}zP3\,/O!Ӄxsz?Opo߿{3ϳWUR|zJoQbK8W/i!k9;āx`u!torO^H||(]yћQDi lͫwp6 u2wE98*^EB3vx@|zA\~6/`3vp>|,-!h4zjr(Ӓ^%'@,_|Ohn\F\#oh[{:&Ce3hP̔C*;Txڊ~Ah7GŭE >hM"DD*YrDh 1< ƒ/ D%ExJ4|C\h=jOSUG-'=ܲQ1(y>ED٧et1>gL)[&6&">,/~jKH3Q|o i8nI':7T)If?HDHVL7L-w2bRB74j2Ic[}$i go=Hu\b&B?q4H $a]\-h#ҿdCV*M jfE 6ˠr}<gpȌ=w̚lŔ)9~ngs&YbE^U2I"qjY/-/QE!3Ɏ ם$w$dzQE86oԟ#i*&w@!Y0$HJ¥ CficuW3Fiɷ9 ޭ2>nߌτ{xa ^>٤@1_*jmll5N؇-ehoTav(4-GH|Q8G2[2P%0%}:K;9zi ΑvײS* [ti0hk5+J/ry`WIOZiB˗5ٚhL ˼w&IKo)`b&Țq ȴV هꎫ6Wk yGf\R2T5<(4Yu#ކ&K@!WY|#4JAOI + QOV"ׁ2&g#kH=e¤^5G0mD)F?3/%/M!b_ 7+`D7@dWi|/h[/V~Z݃ZY`DdWDHyH.,7 51̠PAH.X;]}&0x˰KWXFOp VN 2lvt3O̳h.Ù_@#o !ll+BMdH)'6>Ke]Q!Ϻwr묥M/x݃N9Oח7=|-~4~F)Jg2 Ld%P%-3EmbZL4džl%=qBscOvt-Saaz*!E1vWo52D$ԬIT*2j\oΫ>L R zO|^,fBⵕ\;!> ~/AJѶdH1=*܂I/rծTҰGTf_S_OcPPMl-9uDT18h=koh<{dBpYLȴOi^ePVjt"s!q$\<݁!dG_|vq rv'=7x#]6Wk쓼lv0h9H-^}Ւ_X.'HUtU~#Dܼp[8BA9 *AEF$^U`& h^c CH4=kG%d+R RS[Di=CA{-y ~>}|>|?oO~ۻwKfs82({ym7`uwָh^ xϟ~ן7r }x=.g6WDV>rw?Gl~K?m ( k3˥VS?޻~kp|0qֽrwIإkcZ^S-wܡ1w>ӿKyOKo:s.#hrkܪJy^/xAݽ~}חƄcC|۶ {4޴%?X+|o^?Vs?BSp:(~w ;Փ] "re#+ x9m9Q\,9݀CexD \Q]_}T#wWtb"k_ݽD6$Їtㇱw_k?7l{[ĩ S3:fخ~SK%** &b{as5G}ZX_2kԕ;GՇdr4Tx0qOצ:q={haL`9b$f kYG(W)g/la ,V O2}>P*8I{~)"{ҁ69T379%:Җng#iW2\sQ݂a-VC6]}.qV]qrltP9,9,P'5C5@`9ʐФl2Wc`+0N6mۼ-*;:o<9"{D"iT?y6gAgݕJN/}/Bj\粑[ j8r'ڷVe@JJ XCA-R ^] Z^+5i2g%LTj>P;J\lMc:lsu[yR+<[3x40w\.)R掵ֳs %';b=6Fp?]~Q WJpOG;!ӁXnNMձڤz;3<1`݇mD'(Cs5tĔ-*qIѓL&4)sasmd)Z3 G3^kFx{{JN#XBwa õ#׺U5̒@8xOA>68~qfN "9|maTxk}~ ґ$ l iM2/ź牴ؖJ_IZ IPc'vXZP"w-a˫Bmyץɡnԧ$S 5&f* թfШ1N%ch8^Q:~HSww} }L[~$Ad38~hUm=ɨJSms5`E{]ri:<+ y;͕xsާ9*cO#[k_9 عꑓ:Y8>r%P{R8DUj [1+`mQ΃1/Zc{cW^:s=Xe,%oO5.4dl 4v@O"@0}Sﱨf~9 ҡ.A|Vf_)uЖJXjPSScv4vMn[6G`KF$-ppY#'fo"'&:ZGBQ/&n?^rݲ204>Җ.! 1STU MNqOJ`G]>fzʪ@UrJQkPp[": bYxZZT5 W׆(NXO෩!NdZ_ٜG޼b եDJ.O, W)$ w ЬְSu~rNb(OLQҩO~ia)dWۛR\> ϧ]&qW`=\nͅ7Y6֠"kU(KK^Xt/j-xǞ#I\W74EqD'uڟv2dĀ=B: bC^ǿV7e?ԇlnIɃ"^lr`\]p7s49W%r'b1oXf:Ď#QQiNj:6P^f os(@VAjps=GZm{(^ܹsG. (/Fg]uc0؄;t&8p G,rfZ]5ɫ̙X`Ԇ,1N*)fx.9&v2ѱGbc(Qc-,y蕫= &>1TɵJǴ/MG9 'Qm&y@O}[6K\{愃/64<u{ytLJܓ-L#i_ׁkshl l|,Z3a4 hwu/uMЂh751խxP"U]ܬȄJ]Im$%rW䄵p/ao{hBXX:#; `|u~C.<ҕc!#G`t9nZe^sR¹pۜ5rK/=RZ=(ӁIљ쀅ԉ—~)&ϳJfFgÃNE%S*Q?7<Z¤̟0E*U{2eςm|zCgeWUgx2`m4s.؏Ʊ֨s/J2t]rT}"mx ȜE f/Ľ8)Fv'tc8VD.4r,L;6iNe Uށ%y RuI>HO-Ԑ4cS/PNVArb];׃'w=T:6F;zu&Tƈ\·)% i9:o-v!\%rPB)WTE0i%–~!M)of]mjoaQK)ʨG΍FS ]}Q{D4[u@1mE}^tk?q5óMg$ XU֏xF3[C]n%\.%}e7:m+Ɩzy}Ft4ʗFu>|N[݌+6rOvkM5?h~h{Kxԧqv#\vQŦFdѣWI~<ɔYPW }{^J4tS ^= Ðho?vzRVOwųJ_d-4a)7w}XC9L=6,w3ݡ`3;Dq?6l8R.F;eyE@dV &[\Ae0[2^] 4v{(6X`BAyƠ_)MNvaJoS=+[*V\W#S!wifxO9]ھV {?@t}Bc$])@5"j2dO@3p) ih ^mtaZցNo?ƵgJJ11X],Y ?/[%*@-樀nN@o>ƲnWrЖ+{+G-9zz(8u P/Ls"2kIT_ӄjP\,jzvwvF}xded3Φjd q )S8lSaF6⬇+^C)âNz_"*rޯ[ ݂t*Uk2u^`nAm61˪]ufwp;,DB1Ip88+E|15p}RQ M_:IY{>CB0auc[$ 9ǭvlhw(x*WgKA_uJvXpNUak ā!Ez'7qH&N"خ, $39 Bi,\.T2K/]`" HX y 5q 6/ar$Q<=uԞ FjT(S+i8 )NôzF]\e:u*U>Y9F lq&QPRYhS>LkzpP{!؄:jIѣM,G0K{4Ez8 qp0+ ѡ{~hSD8[e;?w븇g.-P}mrǮO])cῲFyb¹֟skӵmՉ9LM6 Qص'_=NHNbǝB%KL9UHm\oyk'&F)eF <pいZ Ѧ" MR%:%EκRj=15rדZ8ʵ,]g̮y[Dgn֦:MbT LUPz v &Y,Gb TnZ_wr|g|$)b8_XBoRPD'o̺YF"?*˧\p[Zo*Glgv7 dB1Ψē'3dt--du-ݞo9GA.osCT=^*OX{ h? G ob!0Sxfd}&EN( yNaj`y" ঞclStau: 6TNx^x#" MF%XZBա:?йvUB#]}=IYy^vU- =!oo(MN]minY?;lg';\TrmU+Tݰ8T2$މbsey;l#LxU{91ӏHTGK}jOѤpfjp|9sW~j:gУ3R#Zf΍ R%تeag\cnU=fk f$pI}jFkn3ZSb7{k#y)4ae:>v=8}7Ge/ډ*NU"2l8#B1a|$OYdFx8|q3g&r&p"\$Й ,_XzE9Υ , 0Aϭ0т8=SO{<}:՚drJ $Jfz(IA6lH1RgIIqdLcΪ$Fu|NbR5N ӞeN|=y:Ij5ɚLt+|ÌX^Le 9$ CSU4jRgndFVn$$完Yw΅MɘL;CVRrM u4G|G6@I[ēvč_?w"_V7v}$)fqxxV9AoRє +3-aKGEӼSA *-5"=`$f]aj}|çտw\E46bBNop|us8_s8=8\>% whAlh`v lS:GiჍ'7[x.5\TTV5`"nS[Ejgȃr mӖ4p^J6`E#+i@ gy>P53f z8BWO?nr)Sx`t xK]h4{>F\ endstream endobj 5 0 obj <> endobj 6 0 obj <> endobj 7 0 obj [ 8 0 R] endobj 8 0 obj <> endobj 9 0 obj <> endobj 10 0 obj <> endobj 11 0 obj <> endobj 12 0 obj <> endobj 13 0 obj <> endobj 14 0 obj [ 15 0 R] endobj 15 0 obj <> endobj 16 0 obj <> endobj 17 0 obj <> endobj 18 0 obj <> endobj 19 0 obj [ 20 0 R] endobj 20 0 obj <> endobj 21 0 obj <> endobj 22 0 obj <> endobj 23 0 obj <> endobj 24 0 obj <> endobj 25 0 obj <> endobj 26 0 obj [ 27 0 R] endobj 27 0 obj <> endobj 28 0 obj <> endobj 29 0 obj <> endobj 30 0 obj <> endobj 31 0 obj <> endobj 32 0 obj <> endobj 33 0 obj [ 34 0 R] endobj 34 0 obj <> endobj 35 0 obj <> endobj 36 0 obj <> endobj 37 0 obj <> endobj 38 0 obj [ 39 0 R] endobj 39 0 obj <> endobj 40 0 obj <> endobj 41 0 obj <> endobj 42 0 obj <> endobj 43 0 obj <> endobj 44 0 obj <> endobj 45 0 obj <> endobj 46 0 obj <> endobj 47 0 obj <> endobj 48 0 obj <> endobj 49 0 obj [ 50 0 R] endobj 50 0 obj <> endobj 51 0 obj <> endobj 52 0 obj <> endobj 53 0 obj <> endobj 54 0 obj <> endobj 55 0 obj <>/F 4/A<>/StructParent 1>> endobj 56 0 obj <> endobj 57 0 obj <> endobj 58 0 obj <> endobj 59 0 obj <> endobj 60 0 obj <>/F 4/A<>/StructParent 2>> endobj 61 0 obj <>/F 4/A<>/StructParent 3>> endobj 62 0 obj <> endobj 63 0 obj <> endobj 64 0 obj <> endobj 65 0 obj <> endobj 66 0 obj <> endobj 67 0 obj [ 68 0 R] endobj 68 0 obj <> endobj 69 0 obj <> endobj 70 0 obj <> endobj 71 0 obj <> endobj 72 0 obj [ 73 0 R] endobj 73 0 obj <> endobj 74 0 obj <> endobj 75 0 obj <> endobj 76 0 obj <> endobj 77 0 obj <> endobj 78 0 obj <> stream JFIF,,"ExifMM*bj(1r2i,,Adobe Photoshop CS4 Macintosh2013:09:09 12:47:56&(.HHJFIFHH Adobe_CMAdobed            Q" ?   3!1AQa"q2B#$Rb34rC%Scs5&DTdE£t6UeuF'Vfv7GWgw5!1AQaq"2B#R3$brCScs4%&5DTdEU6teuFVfv'7GWgw ?I%5I$$I)I$JRm ut0G-ip}#X9R<9k{nKퟣo=^߻Cګxp^Ț7Torqr-rtޣp.k 907%# 1kEծݏcȭϧ],pncȭIΩ.7q}>1s]Fq⌌#QI+ 3Vf=!Ta8"PeevQUV$`Ƈ]J/zn-}ʪ-6Xlv7]|)f?E5Iz-Zŕk3*PBGԞmp[zC<8IzWɠdt.l/k|q=^ct2OP-UooJ=<0z',bGG-$VPB$?XzOO7uȹ{jkK oeUqu?v5c 9R<|/\r xYp&lBψyVb}ToOͣdۑ{nҩ+=d_>:[GH9<{^ZEo'෥qu6Unn}>Nٿ캥K{-X\#s×Ng c?V,˓3d|󇺻$n@D!.:R1,m65k^9;m~}6}[ĻA'oscͲQ7QѽEYUGN8]##V8=?EjN0 -Q/D`ێ=;b>}`}2(!}knYo{zj͟X>j?X.9 +=^Vng*=4?ˈc22rܷ-d?~_f\u2C ѽO;̸jR|l}q8l<1F<<زK9<#0_Zr됉Lcc~#ֲlQ:Pi6^};h>+c޸g\:: ߵUnXC}(mлZgKԹh~y9G1搑<zI%5I$yyxىow@3ɱvhfTF?^fPiɩwOp(3s#N>SH>~t~z++{w V'ݷg-\ڭsU+x-s\9k~t :ZnF;hݱo**]^]+:DF sG_mG&^Nqi<~gRH F!%I$}LX"Z1 3h;L=^tæeˏLHB#P8]3u8w.=*֏ICLS[Z'e_l]oVZ¥?A%+ )ķ k?)Sln^Sܧs8@`t{[DZw ॑1e׌?vXG}C 2|A:FWW߭xwK-q"ƴӒsy֚e]^7HыSkY-GϬuΔE. 2k?ʲ[Kͮ=z?/ ̞*v5K]_u:6mXw[mLk\j'oW닂qJ/G4I O <AIZdLjߑZ@w_:"Ӎ_jr8K$Me/?9YKDtʙ1ɥWX-kz{Y|Ιpr]ϩfKw^U^_81J\_9?{k7w%>z_خr]MdZ}aQEvg#zwO݇Ze8@驡ӪzvvЀ> d rc8c/oLqnS3p::3q"n@iroU\ZO_g~-Tml ?1 \/[nnCH=1]e*3rcG? "I&[׺QE֍jp}un[12N&e( ߳SпL;Wml}>?Fߤَpr!BZ?qVI'R.'RIrI$)$.h4!)dIx1i׊lL3ns]Q>3WU8c:}vb`SǽYY~Vn(I䀞,GrIKێ a_u^gB['Z?:eUxo{;iuz)X݉&'. x' rp/dǓBb֎VnoʰWXZVw.x#vyc QX8'a=nVnE[/4X[{r)mL˪qCgENdϲnvF;ĺacwo}j*_q~/%rXXWa`:۾}"TzM ~CWmjR C    C   " }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(c ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( (g_~› {[{ˉ%4wLʿ/;,9a+V =?;;+4+;hZKv4#1eej {'Ѿu7 ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ?9k}ҿjqOKI|3/Oe?G-|g_f~_A_}䌫_\MO ( ( *Γv77݊yn_k$Q7̭^&ey.Y.\v.46mK Zg"sڢ|,_eS>ҜS:!TGZ(𿈼52ïhyoYUoՓ^RU#8>w_z1gN\ (  ɤh$kKY%Uo^#G O3#K݉Ekj6bu{;hH]2xW^ -Z:=""e_ ?2ՇxG-̬^{ܼEz)Eo7eD|Fj cV7+,ahL<ΣS%OfpթӃE(Ü((((((((((((((((+H]kWs$J?5=$m/&g?g$Po}e?G-|gUc2}x>QEF<{ψڳ]%g&۫7km`_2IT~|5՟|~We*2I>u~㯈C' t%%=̏.*?🆼7z&kƻeY75b^|\ikwY|cyw'?׏0xr547Y-Yٕ~hUL8𗎖UZ>RJ_(K[_WVG5{U{|_R~&O_-ԟ/E?(?)7+i7Py8Uiڭ[>}DvMMmRBzmwoUwW"xך:37#uUپ+eAǸ*u-jי,+ʼnSh\_{-Ju9lFf9?9U-0SR;ZYRJ״۪hzY"Жh𕿇V2L(ԓْQE0 ( ( ( ( ( ( ( ?9k}ҿjqOKI|3/Oe?G-|g_f~_A_2Tx2Kb.%McaEWW>{:G? G/mbwZ;|7ɤxV.[eНTm+)kkVh]Yw-*pU;/˶ipT<1Ǻqq'fIe? ' kǞ^hխP8aWlVڿww x ?%8rTI^uGaV9*;*x_E|?Mmv| c׷Lʑ;4«}{zv>#'-^hҴr/,mkx*⡄gU2n-웿4c8R| Hzm.oEkm œ5rKJy}~j]sWյżuKBWgwpɷj3*f<|9?iMFVmm>bx}qiiЯ(k]B]I/W +;vȿWcɺLkmmMܿW_?|Lnqmpwոe%"{_#4W+nUuoo5~ܖ?`u_:Ro5xQd|a꺰stړq^vik&l<63]5UiWw<4l*ȌYYw+-|o5ċzż[+GG_bE$~dlmZ?^:uj8hmõ"_e#Ы/&C!B^ O_h:KŜ̟l2/Y~jS-5 tJoD{ ٞIfyys36f}EțA?]~)P)|Qtx S= f_>$EkokH??b5?E&q1:t9fp~F_u56 |Ҿ>U/<)_|yVB?5x~o?Vx9_P+ ( ( S I?xuYZ69_=^?ɫ˸; Uʯusmox-9M\6Ocj*^G|Z]ݯ|"x~_Gs.?hfm%ԇ߆aҫg>~-owЩ>K)F]E|~ | {Ȗ)-u:fMiiw~Y뎧 gt_ȯmMCZ߳uk:)+~?v_ ILN,  _[B#fF@'YVYB奭ʿU|S!>N+ȭ']/ނH$Yk>a:xlW~xBgG/I_wexb#iz ~x/}FZ[ݻ~vlӾ=^&x'sOw_^OڏWV?Of|k_~U_ g&׼U6 R{Uo5Uek_x7O7i4ڏY eZ \;AG3yj͹毡bWR]{yͶLu:ևuczOcyݖo/5-7=W,˱NI}_[>k>kCՍ}[ᧅ~ ٤zիGu fĿyu쭢]x[]cHAWsCV_k5_V?jqj/\nR˲ʍsISW%*|^=/mD[kUqff&fn/mj6ܱɵ8\w?hox줶m[*s/to^S#3dvffmU^xVMړK;S|4}mg;y)exFYk?Λ;;٢6oy),n.,# [trZ6~oyeUW>><3u^gß x#M ˚?[<^dƹ,{y/=חx'֍nvz+Ǚr\~ ZjG>__=!,U^RӖmRiG<'>zw?;'7Ú\V0}6Hfo?megqoϋ>_ldy ?ͻpn7א^\\]]Iqu43oIs3y/ ?TU;)?Kt<{ <}b:7^n?ZӨWzD̍~dݻS%RFE?o?pi*N>Ū˻jUue rWMz_>xw_cz}_o𹧆Vo#3^a'>%8O=$W+Z 5?x/mMhjkL:Z\.nmeF/ZͲc5?0q}ׂ0}hه?#Vc]l7}1\77\7ץ}C,-__p}`~n]O>1_F nivOf]M>]xf!l.&{/UaZV[IʥrPE|NGEj?ڃgMZQßjË6}$nQb]e//~Q߲l ac_-;uԧ*raEWfQEQEQEQEQEQEQEWQǎspOڞ m2nJ+~M^"*MJ"o['_ O}8*W}SHѩ=|E~x+-U\uW,^DMUO UͿzK-'&k1^%JS7htSTtHu:OڐSi2+}m*Xe_6kQh-xuP?W>7.y/uФF=^&fjp:g%fdC7K @/_3E(~?SsXtf| %_.x%VFjzY7Fcִ /QV.#BPB.eV~?Q_( v`k*2yO Ydo1c{ >SWݬ+FOQ_Gx.B|A aș/_xƾ OM/ڲ\ڲ[,__s QwEQ@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@Q@O^+Kռ;t^fQ{J߸O[2K_*_ǃ\S {c+b{I?(=Ŀ |mm ^yS7[_|#C6P\_uP(i/na<|5x~@kۥ3u6F?ߋ>$9"=BuWC\CƯ C_y; %%B#V'ex Z"*/ç<_Ϳs<>g*Տ9B\( ( ( ( (o̐#b8]կkf/KuK؛^Fe(GM_n|uIT onP(8.yR-lꥆ>1/$M{@ͿVk_`m}USOൎIo_ɹ*nffjO^n#2K,UWՉN09rX 8bv"U #g %7|%wħ |>#v zom?ʜޅ+.9)UK3q~0,z/?JįFoxXQ唷ʿr? __#X?G|Ear2Ӥڻ+?nDOg2zVxsC旫+KP2l#LOTmgU#.?gd}fs+?iniѭm7܏:F4ZK\0_?@4Ow]*&?k eoڇ~BGh,oྶ vEy6g9N??FL}nj<)HD./9/ko> E"̬|o6U|{Gv D w-|3WW_kwt~T7PCsnBG]_ Ɯ<7PޚٚfЗZO?/+ qS[n]6,wgxzT[x:#.įٛX?Go}v/uOY.;]bP_}O+k:FǨhڝjeKh}+<YkUK_oJ9?< _ždfڭqr}s h~/燼Ccޟ{T}:_~$]/WZ̲԰,-6.va*yNj!oMO>dQ+p((((((((((((?_Qz,,-;Ruᯌ4?&>:aѷ#e<_5?>xt-r k*]no?_ A0?e} _\cǞ_ ku0n#>̧ j '_x[R,+ Vݾ-ҵ~#,XeH~GKT[xDV 7Rʱʣ}׈)+$++ 6<)QEQEzG_KM&?VoeP/WzIk`J"\Q.X|#? Tڎq(M_u~̿w|-<@0Mvmʷi޽o+Ӽw{ =#Nk%VbC R_/#ҥ5bx_©kisjQqVf^7J _MsĊ04i>Kv?ZOWR>^G[|s\\?Ykj)w{EWh}_i nGh^Ot}k䏊wo/!ݺ;5o*?b_b8W+zT/斯W=Š(1 ( ( ( ( ( ( (5!WQow 7~ OjxB1N5:J[?*s,.clMҝI>m.;7~ W,͹3ShQNPBۅJҟQE{&aEPEPEPEPEPEPEPEPEPEPEPEPEPoðݾk?TzW??'i>/әD7.\a Ug%żp?~Ǚna/_aj|- NkGKJiD_Zi|qZM<8u,OA_-υ~]Mg]kvOq_i5ڤ>6?O?jJt^eϤz/^䯊;K#H;6fmMI$QE0 ( ( ( ( ( ( ( (i+ (4okEUQEQEQEQEPʪd$)5&WD&}y '=RsMpzI;4^u/^K=TdyU ͧ_1k;Xt{[德Vide۵ xgM`5k5z{`4RZ劷K|v]Y[m}:Y6Hd)<ݫ.E>>aHcM՛dEde#?.ʼDaQ8-xY׿2 WV.]OJ [c(O:$RqH"?"v<.^Jx .z-Eo_R\4kUfmSJFU#/ǗQZWKm|=<q -5ɻZF;;x,,.?~oʟm |eK1j|Qcl<*M_wǁhmP[E]ټdz{_TJq_y370ыk̞ :dڞ~?bL2(WŸ|yS@̼$I?Uû? Q~wLIu)M  y||WmYH5ގ/Yv]|oIJ_U/C}0y#wOZԬt}&T.by[jF2M~o/^&m;Jk_ MmZ[WWB:7x^$l'[ەo~M˕ qN92>We8"QE~pQ@Q@Q@Q@Q@Q@ ͵Ws5| ZծlW/7$\sJtF'=$RE|rG˶_r|nk֬a[6o 6VmXK7Q Y)+/Z_kcZvWO̲`}+*2jt"6VVik#%]%ɫ_+Jr}k[0IWُ/!=ͼhͼ۹ao^mh0_kQ.fMʿx|K 0b\~hS$W]y߂/?᮴,Sz\&n\Oi~/i\}WuUWkHʿuwNjyKoKo"ewz-ß IGD0Y#|ry[8c2\(STJu]NHG[GFT(U{5kS+cԼ!n/ȿ=A`|v++i4=T*rQEuQEQEQEok~&n?*l5yL>,Xqanʿ&^G|#ďAyeimkKs|3mWox/ȳ oկ?~v9nUM^OEu+?9^Mд'ݓk$4?_hw67A27+^uHmْ(t2eWyVۓپ2u{m_5٣~ڹx?2 m55wV<ʰ&V_+W?c}cvW.me{c/>J5(bҭyssqm_UoC^l<'zuqrmm Mڮ~&>.ϷQoWe[M4w_&-LoVFYfwUps2⏭qXB]6B Zңm_ L_y0> ׼A*Ico,33~$x^:5Ffwc_ ZV5ohnʲ]Ck卙[F-xw; RneHo]+kW^(goU >޷5sYGỿ=Sz律Y&eVm{jH|RF!xO^ռ3 }kDk[]L+|u]XGזmk+Mo2*W&s.cFR?iu{Zֵ0˨+J4_~ XuKvd3+ym{[Book?qФC0xYS5*7mt名*FMBSZW 7?񿌵vIk+\7̵`0'*nK/=:#EW \?j׉$שL hLxR7%Nfo'In Dͺ6?{m/A7ƾ Yխյ~i"c/\%r?L~כ:&&_o;|}_^AUŹ2+~5;ER'73#%]%ɪ>I[XBؚm<[]7 X?ʳ:yjz?3 U-~_?fx(կ$Vƿo.&FigIs37ff_>"/ۣLKttm}nk拈gX9#fVV]<4ox?=v>V#3v6z_뗞vYH5ʻeܿ*ʭ^!EeIq\G{s}ޯᥖX{>Ysk[[&7'{ڿ#~&Uq7? J־x-|3w²\2u~Xdk*W||c9~>_/(lB(((> ¯ٟTkG۫}3֯/Ff׵6f2O*jժZjSǷlRL̫_˱~c(֭ݾ%h^ = V9ԧCP_4!5 e[i {\[Yֵ AIvM_/ynaR M›{uRe'>eݛS5 :;[he,[[Bw:~X3ͫI=}gpCx;\WЄc68.챿Y{'^~>6I\v#7E oh_7^C ?=dUڧIWO|Ell9{O$燯<):|$o-UovVMIuLܳWvyaGѺ:kd Cuygmfy~V5]~8E} emlPAmEwK8zY6 T;ԓMzAEW֜EPEPEPEPEPEPEP]'+էZ$$HnY5{[ XҍNJge52*Y%m*^GȲ >UR|_Wumm?'3m^+y$oe[[i?n,vFM^?cuugpw""北PνM|dio #ISϰE~9Zw6kg[yv!|;OapVl?/K?{7/޽gu*ǫ::xZm͝mdK^ l^i%}[Qvz=s—x~^xtȓwפOjj^"[x7zFk$ msgIݺˋˇym$^3xψ`a(E5ɶm͡PR|} ^+Լk+jVKJ,1ݍݬ(0 > O $ ItKdy5*J9|L($((((((((((((((((((((((((((((((((((Fum}&Fum}& j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgCzg j+gCzgj endstream endobj 79 0 obj <> stream xT_{bcQQXDE)"XP^AQ R+G3x;s~3z؊hrN7PrT (3TP2C+ (3TP2C+ (3TP2C+ (3TP2C+ (3TP2C+ (3TP2C+2kd>V;Z낋W流v pQX#%k)' ,ۉf 6r"jW{)6]Iqetqԋi|]D3vLX2vzW7\@a2 k5MOR݈ 4f~)&.?{*z^~2f,ϟ5& dq03crn"aiBJA׳4MqoR[_E"X8ytI1/[L3rKN^Vs+ZK׎8$*cձ/gJm9M1?<)+'ŠybٚB,Y}✨(b%- _4׶fk YFj1lU'&swl9u'l 42Y-W f ~9uW~jlui2aW@9to+3a/s%oTx vZfv <3an®fY{Ljjx͑L d;3bx#ītf bbuF W$}n댤tff=ʽ>TYY\`TV)YzV:3+r/,q 0.b,# hؕ0j2h9 x`f lo]j>t% x`f+ 4_Adu'*2թtfl^h Fopѧ<<*tf^`II]č@Dںv~*&.xL!+8q>UΨf '`VΌݓ,kyc3qSL:Ξ ݳ6'^s$>֛ 3%T)ͫ~GP \[ [EH|0c|O<j1Mz[,6)(*2OןhچD2(edz] \q*zM$z~gaW$*{1:22u/X ~x;oDN8;[,>uZ;1[sr[P5A1WC]^(WR.Hfs=?~v▩þo(@X%D̈/ 4S"QnODNqDèϘ\R4{r/c!S *c#3)ǔ 5/$8z>jY$NItǟaǯ?zѰ锕œVzǃ3"X%svx>6C(*[ʬ/f@`ʟoE8GTr ,"qfDE^pz1TL\ a,3HmLKnp3|OSf;caِkſIUnCpO0 ֑P~4A-$3HU{_e>u)Tked^ zfl:xWkfjdle.x?{>#{{ a [1SNZAz#} n~vBzĿMmDv) y(7we`.u2(+GW㾛CfdKb1 5l 9'^PY>> 4$ckTT[XWor{(d$$9V?9?˗`=%Meyܦ\7n?wFk5 w")CM1\40^ŽI*򌡚 Q1f3x{%?xxߌVS̄&.9#+]*LǮ)ݰf =Կj⡈.x+h7rğT2|El+]gOP8^6 C z23!S6Wir ,xUNf?ئ2#xZj?PA\G9 ^욦80hk*LG6?~ݰAI!'_OT2$qnQL0B _M&IdDɷi{.xEiM׼21S"PחK\'?ZDLIqzqھg݈[_SwŸK = LcjT~<*L0cIQJISqvPGw  TE=/ξU5k^*UPJd8̭C?}Q맛i G_9?O+'$߅T+գ4H N6ّZ<~_xeյksɶOx{FG^̋u5M H+VsKrw>fȴs]y쉠*n[`wu+kWkYџ3kf2sNLc7i|~smxw^Iw;%崲8t`GJtyK+d(Q?-v0Z'>/mۺ6o]T{DCz{w~tё]MrHu8:T Iajd쳂!ksw ˴`޳]ߡDyU3YĶQ#~~瑖y֐)BЩܮ'=̋kxb  1ka,+P&+X۪_5I3v:"-` !ťlFclhVBp;6Nf GfVmпr%Rflf7MWm.Ȥ3Z؟9@0shPvJ]p]Ҧ_g5bkr$5wë맆VEp\ܼYZ 3~_f~>}5 A{O 3IP]ڐݝbVYO<ᄱ[לOLI92sva m6Fb|lq^DS-{Z d9_j{Ίsgg(4fPBp}ha2ꃘ0b )ٹ* Q463/cf8A@+uՅ}fC' >bf7pFM'nkb( -Yc>qׁh{L/SAfNDh/ .[ۓ;3uQ.tz\a٥T串izߴ7.:=*dayo`qTK@9~YO$ '3 `hF]Gꁃ5E;3Ɠ͙\>ђa$m9hƇ2@tp[ȧ؇͌qL. wmEEf 2TEo0/-|"n ^Cl#[1510@BPm]Q& ̶m],\.6]#t!D,3]'nQeٰAᨨ,baưMd@L_C2O2x(-LrHu ?smbQX^n~g:9;R :IV&5TG혁H 3&L ,D^y翗eFd >%w=h0{ Uqd-,3p"Yf>/AT10t̀/+hB4N|#|f¨LL`8J-ai `r4<#u6: va'nr@{ͬ@n}#z1NwEϮ_Rҥk{=ΡQ3m YK6ZDCQ<ZI è \ ˗<)3QE 'Tm #RsPQWO22t;a0}cf6A)jel1h@쫀*<3e2KҨJ ulT&f^FWNnlϑZX }">UǪ@r\S`_ܨ+V y2GEEEEEEEEEEEEEEEEEEEEEEEEEEE%p A endstream endobj 80 0 obj <> stream JFIF``C    C   " }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?(((((((((((((((()>}& 1ԓSP{|<}jA(LQ6pOM+a7evOEDdbґcT.Yzwlͷvz*wn:oSR hIO=J}l.IE@c<緥+T%<1Ҭҋ%i@y)8LMرE@]|?J]I(rID{4:Qt&N3†dUhX}iwZ@>E$j*L;W- ᯃn|EJp晽|Ggz2rOWasc@YIo%̈:S/~#ii+ܬO 88pTV{#b&rD? ,/MN;MBz۸w}4j暦shǕT|7UNO Z_Iu.8=z'WO~+ɞ XUaМ..#0<;kB [`{ozRTIWs5`MrZhs_#xE"񖛡?\,9]x]G[ ,/VK/fi#__7{MtdmTyy#Wߵ+?4=B[oV贃Hs[ ~^Swko*c`ps1N#>0|e7]ee$W sG@f=z|-XtkJ2/_Xe:RZ|v*+(?h}o k:]Ě ,#yrQݼ9d*H_ÏE&?,=:mkl]hQ?T9|G?ͭs],&'nXfT_۫ŇMX!ۊO,5ǥ}m ¼6qs+y,OX88}J-:_>'<ҝ ﶯ>H7&衳~=+qWKh+&~~/ 5+m$I½Cmcq?p_-)mq"~[ᰑ|D̺{G_1bb}Sg?m>'tOYh6p9OQ>#J Ӭ" iվv]׶:xB[>"ȃ2_w?u晆SP\fpت'}c|\Vwkz°ڣ,𒈎:, WgӻWjO~FϲlDsܦZ,=  B-_EcͤRwQ_[7|{zΕj7%ҾT1xQc |;k,2FؑWX|fѤ}'&O\kp2`Ւv~ҡbUWڝMW%=!DtSj*O=F?l~v$K lqx?W? Gq/i"4u#=__7«n49Jz=k'⧀ixJ[ɭQ'bA{Ymǂ:WC2NֺNU< $ùkX$Nݎ #>|-Qހ>%{'yjpWKe+ž2UA[&2HLuׄh'͘bѻc<{U RNg'R?H?l3X?ӏ:3L5a .GF;s&OOxzo͢ZjZݍn'{wo}k՜4.RDl_& U 2z~f6sI33FOVwIr5xIX!\Z0Lg3_fUu-|=e(;KO&ta|%խ|n35!JͰbOf8ek ڟtdj q NzS|ԫy1tazWQyYclEjFrqjR1$#ZP%p >q6|)#Ҿ _W}U3%Gdž~Rtu DkNrA_Y=(? Ytuтmmb#j?f b`kMs=~~ك05}]˖]ѝ>5s$AƍM&rpv.`;[k *XBxfoڻ .&.]Ěύ4~:xe7s' yx=yb}wҫIQt|+Z>>յO~~CE=.p?|nzrs_M~?7~Knn/2I,j9^!7<=H?E_Tf2^y6_~0xrVl絎o,sWIp|hI]QMI8~41xhA|HP>߸>%+&8no$EB׿"q+4#6QTjN7ʿk/|Ys6_@|9HXz?<^5]~YBU~Z.Mr7"( >$VV/Ϫe_Mo4r Oq^[WG' N%}V-t[r@`Y<{L;m1!!Ina[W(f*~֥9숯J4'sk߃\ntOVgʹŎ;%뤒6 dzQ5k6K<v Gj_Kݼi "f< MZ[T]#>(Ž}s3c5+D~>i'׼i>-sobڍvG&!Oks 4ж3J3B"51# J|W< q{ğt4=6k١|Qk)ODgt&RtKTU+zJ= ҭ#ު&2);FA<>aSKhUlkTSl_u4K˫;8x<>^9?Ww𞢪$pE~9wwщBn۟΍KƞwDeHbP|?:҆eZQML44][U$Ҵ./>*ą><#`~|H Em@:&&8v Fk FCuA~uLµr4Zf' g3nAbRl뻊 lrg5bk Kb}78UoECpAU$|}k%6X4b^͏u?s5Tq$$tQ睃:5E2N5-lxR twONմOl[-l 603Gʜ˝,1ʬ]}O3iV-jGeo++@t31\zV?&]6{V, dsoeCmiwM JۗL0Q$g}8#.>e\_+VOɽҒ;.#00BOt:q;-Jm6n KۗT) ! JPGhʍnuoM6Kh'ͼ3'I*A1z`ڨү$ta#*W8^QD0`) 07IR3kHo۹#K{6ο1p Tִ뭚n4fv (n>`8}PčFw\-pѡ5q+X~kֵ]Yt]YmcoxBrQZ~ ԡ.}JZX,{)W>D'mT9cCmGּٳ_iWZ΋t[&7I=aT$Gn+gOqkۍ.H `9r7g> JNA8"(K>V If{[f;'=|{xt ǃʹ6ά$bO#־򔜕Z;xQ6JҴXelx쓦j#5 [qo5 U}3^QƧ Sֹjs*Fĭ%ujZq][wU~\I+↡\e+Y+~czP*u`0vG6+Ij~b?wIeqa~nZ y5zc8唖@ߏo.?A 1]xЩԯ@29+lpV27(.|?Z<7c*^Z##~SҽJ,m)*,JncDtT u&KE7bl\bE+ q6siS6MN}(ؾ(5vʖnbS_z6u݊zѱOju݋B(6HP( _J6/LSlZu nť)h,()h`((((((((((((((((( endstream endobj 81 0 obj <> stream x]|GRBN`R(NqAww]܍$]%v8R_0fvv{olGTp8<ȿTUU7tvvN9 66VVt:Kjmm 0~葆i[[oh_Q^&'+{ yT* ΁' Q1QWW ͦD"aFkKσñzBt&x\aa!a87+++gg@_{{[6VIΝ#|sҥR>oPŋ=))uLzWǏ=sFRQA~ qșe{$n~0}s|=k r> ;Sf͚;tg|w̅rW_/gΜy毿fdd,[*7JHlLHHNMMogѢEPpm_v[wB=W /Ɍ?x<+SQQR׮]=ndh%=r,Ydݢyjjg~є)LhQkood3vlMdS&{'ypp߹sN DT*~;L LxΟ'&I>3?d}ް߿off&fpp8!^Ѡ&F"Ҡ~鬳g%E9y8&Qfrr2+}(n ޅ C_rB!Vȁ {{{4 B|R<<_;4$X%%OG~;<^JQΟ??~?)^xZZ[?1cB.L7btmh744t0;чt# F̓CEw49f%cO  ܱ};~1o%GZ>l&LHANNLnwHeb*B]MEo޴8RUy7;vLȑ>f~LLdt*U+W"zCQaC/2erQQ*P Çհ?FG/Z*11aD*XンK[a,wt|:k=K#ɓBKyHs Lp0fN%ɋ/y/[7;a@=e}}}YYQϛ5sx;%%O-_kkk,۷Vf~RZZ&ë_D¥Ѩ]\\ }gϮ+PԩA჻2ҋ˺ytdԴw߅VQUY1:L9s{ƶ $pHG,Bv _}c|!wKC}p) +WpT̟7# rG-`|Ӧ wsY7B˖./[pwߙ8fy/>ܹP`lq:ݕs5٪+ya .!4qJ.-+>U+y<1}={yi /!Z׳ .88 65N7sZ[F'C,ޅx i("ؕ疥KlBq@u@P!i:q'X]KKkN'Mo::FBw#2oC'<]GGG?|ܹ^7>..O*Xȉ:eʪ[&t W*z>>}op:%RSSPŝ]]y`yBE/ƿeO< 3fפhΜ9www_1F<3pwҞ:pto!//~A/[7E'y0 999Y`˖,JC8p`Æyv3rっ;MKM:TTr aa0~^AS&Mn5a -.00VV~MkcG w)*cy Ii`P(:T\\N<~h#LLLW³> ٶl`$0ޕIKK&!s@( |dd(sfWUUʰĪ /7aa262ܱ͛%`>hBCC|듓Y-\"o~ /_|!w֬hjb QV;N-EiD}8}W_0 ':2 FGGpѳk2w WS:QyEpM@-qs^3_rb Jqy/a_d:kS[|bcTTGVJkm+16k}J-d3H͏R!CX'gv+2ss==<A$>HOU8K ;238l6C&V;;ʪD@OFFۻ̼;//55TZRHm?Linn+3 >y,#>qdCt\wQ~WVfKd+?̬-!92B%WWs9L"ca8?hi.)D092F^ @J#zc0NjK3"WTsn."[9,Cqhf74;:ۑq 5 z~\[dqB|˴P xXTWi47J+%Xc{S6&F?sO$!%L5TrEEO  iVF'9N[C㒋eeG}I lknhi(hhE U$a7?Iݝ^bwWG=w+~ǻvw( J!hT 4 FE@24 Ag2`1#f1y\6H 0Sř>x\pX\]E~$!$ 4M&c=$^%Q^@p(^ DF0~xv sJMUl&Fa BCDHf1l6S."K v7W pg,5n?*~x:"Pmc+fJH%-rki9bOWTpp\xH''8k}U/ʝkrBL07s]?KT_0Vo!y]?e5W+w1. dĄ:;kߎrR4.M3 K)12A;\mËJ2ݯƚPo;x#+Qc'~?eI:{7>8/w /5`k&{W#"C[YS044048 A9,&d Y`«L,Ngt :Fe,(Щ})}A$yITǁXpprXpByAe3P6'~v֊vx@+MuO+`D뀕UFAHtx( *<4n %✠q`2 +d2JP8vT,!FJc>4*D??|>+m?u}Nm4*qi@$:~ @bp628`ӗUbueOʅ! kE0!zpa  C"qt`,1AşJ6zrgvic;=u(Iwt~}ZR|?JPmRpRS&EQwݾM7d/Vd)TWdg7{S;כ?d5ZZM_|x᭫/X޿4rf&%:8$a|4?DSH0QD aOOoO7}e/.*.8e*|b;P@?n?Dj ÀAڲ$?A㦍ҥCV\=nEDM !i %J3}6 P[c&{VnlKXrqSJb#GWovfϖ(gO#]ko]c&sg>m!cxvr50H\ﯼqs79vbF ~6\.  ZꞶD:>;W\1Wfɽ1J~N 񩭵DuVj3SԂ`B:=!:iule%g|C݌uv t~?1F^㲫R^n^WUG}]纛5+ ,n[*\J ь֦&܅Gw:i^5<:.AB}o-ŷ]q؁% Oٳ"#swNY OmnVo\)"ݸboO^F{ksZJbo_|e+|tDiDeTo"ӓ l~DH?mU2'th+-MuiIIn\)abK"]Tゴh;I -*;W ? ޾e%w˜Ѽy %TڴRL¡Hg%h?sh{ ߲:xUY1R +ftdNݗ:vN[ٯ{ܹc;ןeͣe%ޓT.˿9j^7vԸqI/.)&{d [ns9xEiR Ӟ‰~MLP1Щ4 cګ qq! 9Il^YSZX~-UW8}i++&rnעmԯ>sŃ pc9I3:k\ջsI_ odr8ކF7Vd'e'Ǵ6rXL6AD&Y .6a,2id2ǪL |rAD YGJ`X,:+A!D{ X|{9+tG ??!b|A G4*W5g(h,sSHkp5vPJvW75=}Ծ$ AtahxH !LA[ 3* ;(7HgUYޝ[{xz't[ݷI'.ixteK[S?CWGj@vo |m*P X[Bd .ߏHzJ_w}£VU}ROgAfjNZBCm%=ChxW7Ϊ-M}unWzPd=HJv6?UZlmP ӐIdB } 6Hw:/_AȾ *Fe Xt {Csd i,)4r/FQTdׇpJL&QH42iD!&:D&DC Kj/և̺2SȤ:&8,zړȜX' !!Y1q@'A~Ia!qމYe=Ri=O򣮶g< yy.9پY^9,/  wtss66^X86_6:fc$o`G=(Zw#=]- EA.9_ <>?Я $ȳ8Э8))5jm_~gw_7k*5]1|wed2P%V`Rec g~S:AO*{ CEضRķnj`3(X>1Gl"sEoDpgC8 J=ͣZ*2,UR7u=>k|q`;.9Wd a~fJ^F YiŹe٥)I/I/NO03(;07 9ِQ\x!8? (RSA~M׿qM*C ?]g˰ of<\nW7u(_*++9yފ % <W xρz#@2#eҨd5$8YQ!$hݝ=]MMOV5V7V74T>*,TTUAXYRTVW*(N+JWo0?;-#5H҅} ܕϙgn.$X{8>v MQ - / Ɏt2T©IYɝм!Npli,UUWj*O+juՀf@S@KC-~v H𴵡EkDTf@P@:1@s5ɟW;'ݶ2 ( %{DVDESpIn)w#,♤x.޻;;;;;;vZG|$I43ڰHV2ђ;z@‘={ K XkD\sث+rr51uq=vqrvOvHз+OL*!?RۤoĠSP c?EPŸyέlk\xis^(QT.+g_`e*o O!<~WZHȫx:8ero/)DL#@MBF3ط$l_2N23 B;Q, 9Oq:vBkj .U "lаp 14tsTW|317464rxmUYY_ o0?Yl qHb -( {9- ! 9Y埯A7E̱݋{?6 (pD KN|fq XY'0_S;`bIH 2 01*/ J` gҙlD&33Y!1Hab[nh,6ʞml bホ?@Q*(kl I`@ ."zUqPp#S'(I% Z76í=5ڻŽQ/.&&T/1ϺKQ~ldm(>ڿ1,2$*2CEqαq5t7,nz[T[KFiH2Sx#);icaU]vIܝk*ߕR ^U*DF'! K#Nv48 ry>0 (g3#}ɢs/PH{\/ @&wЕ9W}5ޝA,fʙJ Lr @fkjZ!V@5bқКxVl1mHXi֕/-Wf2rU)'UYDIȖ-<]^D%KHH5Xh%YKn6͝A7\Z@2U^=$y{.ck'<)İxDݡ/:WNy6Z6~tW1D#pY:`#}37AQ1a k4˖V{#X\E*jйut@ 0) fM : Vuh# *0]۸\9G{wj'oWѷ_ЩbM&rARX 0AD^vyK_5W9&S<`\5窠7ցQa<`G92 I2p^}jװ>*# uVo JjxCD n"&]:.1rjz{}/po#^#Gcxh`4Ncm#> ᛕ}FG lgmڏe\AZ"uK呍2Rߊ~4NT<xanB}2HY}F_^G/z=t{Ҿ _FV-&%j:s?A;̟3:k$dv-k_Vׯ?Tc[;@fCCa}f7FDII82JFLBR-;^NB:84GVbtt *%niQ"Ij T6wD&l [JI-P+ߴ19'dtTıԮ]ϒ_ڙ~q>~NpPꨌRj}{ś+o]}:zR#50+B!PhK0ec ODD:Q")TCc t~fT"Re Y7lȓ}$4l]-cWЈ.^0GΖD"!٦rE . Sbxw[VfAC&1 8rp|49v6fSw_"v7A \T(B*{f\y" Dc IJ^ӸNDLMHF`fsԙD-j\ȤJ9.3W"*!Jb:II nN ?'RR*ۈuTV|,ND!z^cYm%zd?{9fޠ"n:.(ЖRkEdPZ^љ$I oO'I9](Y@_!jK\S :oevLϲa*,]1rd"+L*]$K-2KD&s52RJ1e% 6@ vК1ܫ$j?n fZ^=ޠ>֊OͷFVk%VNS8hvJPkda7cgso?u飽ךK@#vq{f7j^7g54ᬒ?nV/Ҫ\0=B1cu2 )|/2u$ 'Pc-7GM-jͲgf6b/ӻC 宜peL&nF (h-NjW-oۢOkuKuR`r0:rE2mBJ6!d|Cb70f:ub6TTy)]}M b   )h3 +| WZLm&VWA~ZxJ3)FU @QzzlͶs,}R&t(aJIXE)LI6xG!t@AfJ0V"0Bc*B*:԰G{@_/ c͂sRJ%vVEi'vڕ9D`z u p@g!eI=O$v쐾Sx%߆{ [Z]t39ҥ.zWO6gܼH/R?N=T߭*wvP'mc mh $&l» T##5Ej,†zT0Q!7/o#I޻}ƅ//E<:1 D1R03\/]9 nbp>]֒^z gw?v놘z˘]l)e\A¹WӪڢQ_ Uj6!lLiT: )MC\NAƯM¶+;@KˆsiNJy_vA/h |VbVRj > stream JFIFZExifMM*JQQQC    C   t" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?ccr7 W̚5D(}3G⢛ZNPȾ'*mنq-X9kSԦNȁjG|Wuk# d/Io0o`|Jknv':$lj  ʲ%FxJ֒˸aM쏢y: "ݖE;Y)Uo4r08-h7p٪^ #W5tVX= QBi^DzM {mZKnRVk2 ԙ&8 l#$'8{rx1Ej\̯$mB萣 &i2F]]SҖ쭪9kMO7c>a9+x/#>$ZM]g Szэ1lᯊѾqkqỻk$+b@qG\Gշ*ExI\9%&SWoo:{ՑÑڜ" #S&0WK3&++Yo/nmB4ƣ36桿"rhX<]Wzw£>2]T[Vמx?.vf' Զo½/%J.qg RUUr&HTRYSoe{C J;ZQI'"\¯"I-!Whm0X̀CV  =rϧ6ױ+m2[NBT tQM3% 8lZu^6| $ۚn(~8ܘɢ`XSV?* t#Sĉ#pjZ"lkP f2-v'gRy59u+RXyTk;KJ$dR7JqX xw6ۤ.~s +㚣/ïIW[8",_ef2-(:9?%T(uTb?҆u2suw=hx<Vx fCW̃+7$s+ƫLz cJpij'Pry1V?#߭)HI- Fc9TAzG =zYXHV8`CGv?uu/Z g9ڌA%ׂ*-o{4~/,}Mx+) 1:=׊tsÉ2]GrK+ȕdʹAoZ [>? YeCpʞEjFkV6 H1]g ,AdHeܹ+.ƯoNh tyB9}͙ C9mx¾ܗN1\;0({3ط8\=b}VynTpk=sTU9D~eq v*I9= (1R8ƛhӱ[%o7~YO"|gUBI<; CՅcq,hyp^iS]|7G}ZQ#)\- Q Lo;kn$2C)o85w{'½/Kyme`|FnFEyWAQEs֒;sӂ䝖z&˦kxYjLasۖ9[vM"JfYRݣh@xpO^l7ҼAxeFuKs kReX_ذSpF{OIҡfC AUgEX}Auq*{t٫uww?FK}=/ ||=mB8"aacV.ȑJ 8L_ 3I "kQi5Ļ:pV9+|(\}9x"ofǪlqSFJ/^+:UTARϩE4f93sU(>3>2eI ,W q3Z+Y~sC#^3| ,ae;̬G^i7?wc"omgK+9pj?֭ydFOī_ \;I& q,2?A2lq#(CK0/)ygd|6FzqWo>7Ѵ G8F졻FF}ϣ |3B67hv4f%[;LV<3KRQvq$c(_' ~n[of"0ۙ_#k~'HF^1~]GT+ 8Rm|J=]?4yN%c|B$wWma[8W‹6$mCmrӮ83cY;R|Bǜ2sQ,tjj֤x/VSgn*vqcJsj^>o MSsmq[@<޻B8&o!n8ji2mDхpH%=Ҽ#& +dk=췋nL:7m$ޓk:#IΡ M(b\^P3J{+:}ԳeF=3V$֟]l`Q :N]͸woɽs%Esӭk=,FܻTM"]Wr:mXysBS+H +o~O^hz<ԎȴfU}J3:޶-;;0$\*H8dܸ#8ӨBmMF!/o T*M3,gN5qkioqih/֤V8KI2~X`}9SMkiw -Q<]q^GOj^{;,2A* m xp1 &Ԭ[Gi'$k$͸1;B$STM(%jVS~WۯNK&PD Kq 3 |i"OT{C&̲(PH#*Y][Jkrd(:fۍIFG;ZmՖ$2+C28jx(AԓKv6MQ|ݻ'Kķ7-3pS0{ A}g [Z*>\vuC8uMir,e8e}ŶZT%,mϚ5'bz7ܠ+%Ѹm1M3TJkqt:-~;y 5f 'czsT/L# L؟-rO^9]ϴ|v zP[K=*:66ٮ.$k@ʪ%@WxAa/ºeֱi3 s0 D쀎Jx]/Úȼ6x0,9@?4یRZVf،<.i-6 6^ 7_jY͎x#IeW;~(⟪k&n5 ɭ/WOCsgR]fݕe$drp1i7!ѭNӭamt=<+ɵ|1db+-mkR/ԧ!y!Cc]K( 骨S%m9C^&kJ`=9,э~4w]jEs:bNy~5 DsΟxXvLDW!g *0dE 8$fI oᝍgx딒8Pc!7+r9 {m5Zwscms& yܥ\|Ԑ29~^RNw(/H*cxmþKF[fu)ȁ2Fd2>CO{I]Ԑi Ch@wal+kk3UEkiU{/^<9:mkY71nUW#Xp\*#+89S]ŋImcj/R4M}pC\׈JcsS8`ܪI-dk^k Ip=YcԞj=J :KRx>_eM epcʐGz4O5$h|)7RXT_[E;mnJU.X .Xr25kLd8̜y8!WgҵRHnbwFx9kJK'F) {|[2c'Gf<ySMhcb'itSM.VhᴀK+A$t{z _ױChv0*U6eUkm"MS_Y4vLDwP8Dcp&mMMKkv5ɊElQa#?(OSF3՟C6.xT[w>&MvmC]ޤz7Y\FFHfPA\U@qvaLml4"o56,BG@KcjL@#maߦ4oieay VY<٥6`sʜtSϩҼO*YN6-Nݯӧs%O^\% y ;gW.4D.AQ#tq^bu160NQFݙ~_)^Vose; swBTʽ9MoΜ>C(ỷ_SKpʗ ,5ڤma׊&c2r}0;&F&SH}t19xy%4f wm%ۃ^Ulb;r>ShG R,t.9=q'*{6ydoirT? ]-ct T?6xCSC#]jrZ:4`99[|}o[Evkq&衙`N4(-"aW%UPI:ۚϝHnFB\ˡ[i7IGf2,N<j DwPiv#$&d[^&XfۊW;޽Z[|L/J N~q<Z̛ZL0#J6[A8~uKH<&6W`^(Uf ~m"\F (A=Ukd+dy?FGo[/5;%!E䑻36x\Uyo1‘J`ŁQ\ݫi6K Wڨ9e0zA4g&{-:9~qר9x?c*{-wn?~X帅uTiTo sך4r![tl7;zRY!?1ҭ/W$eS+҅$=:mosq3g3zzV/m6oTsm7S A#2*;[HV2ht?ަbN ~U$z~رljS_ϼIq;'5kPUxo 5[IYUK(*(%E =:?Xn6H?}hѦ;4eu؝XH'G*HX LsGbVLzsʟN5lVP#ڳnrAv=ǟU8ɡVQmȂP5;a oSV !sZRDdPw4Eݖ=SW6ݏvqMFKkʒFA ~e=AV-X_X:^=s[#O90AP'_Ʈ AJJ|("-{ˋ}1T^Tg|ZB6GR7IYz݇?/4bIm|mEi&2< c5|+K Dk󼶷kuQ/_Ԟ8+__kaTC)57:uQ%ZiFI=;i%-Ah]x`xr?=\Xi_>BItH oMͯt@}ĩ2Om8b@#WI1<.w草Tw}#`p=Q]G<β1=Rid`vOJ(g uz[ăd5$lGz(u֣bULz ƪ،EWTbM,}؊b-u0QQ-褓KLx*ؚPCQY]&n*썹\$!Gnj(g3o[2'u]\Lc y?-gg*ǔs01=jĈB袥k endstream endobj 83 0 obj <> stream JFIFZExifMM*JQQQC    C   [" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?V>bMqo ntݸ$q׊Uaд?,q 'uv'A- t +m`?.#FTmy}CiE9]%tM;|GVkF3:g>N'SF),ͥБǭz/׈mFk XϯZ1עd$R, 0Ϣ|uk&h!Y+\ĠbpmggӶ_7R캻iӂ9|^;i..4䕜ݐ}8>!{ݔ#<@ Vգ|~,~a+]zP!ƭjN%yD팽\Υ싏*[t[x+~)C&?L1m'|ѲJ>qe:?k:Ƌf:6Z67 wMro_Zjd΀[%6ܯCTpިU 5kefy'75ΗxvbԄ yb? |_kx1g+}ѫ\rp+&ݏ[\Mf8L; yON$K/%5IIU-ԀY=ϭq~*m}z])7cԶU.>kki~eP@S"`jIm¯7I~4kDnGȈeϔ[ퟎo([%sv܌>՝u?lcO?4\ڼjF{jxfc1K\\}RlFQIUPX5PC8tG2I'RV=A#NWLhZPǗDozGUȶԁ^a57,6:nB_Hpm:|ijz&$<'Ľ~!q{n7 z<..#>ihW9`-h9aU7cfY%nt\NYbX nX0ӊ8n:"{(S}u*rI*V_OUeQ`\mcb\r^j\F`Bc\=sum5EHEL2rws؃TR8̞\c"O=(4k/_lq|Oq5rԉyx!֩J+/,α86&/og3T_\J>Mw'שֶ㶊]KE0bVzz+яa Ե[vm6X@|\tNڶ㡄Smḻܱ7uPݮ usۥh-gD-՚ 08=:Vs[s{Jvպތ͒Oed]b%&IG-ܜ*]iF w?|dkU{>tmػLqjqEc:=m'\dOʲU'nC9jZ˂U{x\ȸފ['+~I\="4.;#fb2gҤ%ɼŤY6뎿oκ~YQ/KBpI=JTR ?7 DWn1KQNon[QԥQ2'!%xIC#vĿt5=6YSZ{ww)R5U'k*-Y~ <XgĚuX Km?Mc0g\H6Aa^_km&=Ik{{{-|bV3421^%yYԜ嬝zto՘n-{SkViOkIJ#^H6 n\gŪiR$Rj67 W~> k$FumzKf#G\G3Džh  7v6U֛M eR`F23^UhƵ}"*M%|DCˤ}PhX`}VtNð\4Zx%Yٛpzǰ%dhwNk1wwṄ-&PF[9钵S*Q\Fq'ؼ3oQ6۴G15oGaGEf ɖjs|/9X `N1/oƭiĢSP:痶}^G+~F]vhSf&]c8$z<_];}JТuaչyw9bӻe~ca;|7ss%C +Tc8ztP8;=ֶ I!KI#7'Չ>T- m݇#{ҷִu;m~\\;Ȣ6P@P\n S86'¡bO.d5 )\~`w9" 9l.jLI|+S8217,uQ7#%m${7S_aŽ\q;I##$Zۚ@0Ř稫z<_湋ʒj΍mf'x+sV iTs-DƓbZIsVMm^H젲0>ׅ4]^nm=>Yl:cp pq03\ z[ppX#8*z|u ^nV۪k[qg"Y͵G$n_{z 7ĞE֟u >.DQp ^yV{)uO--u$Zw2+.}xW-fz;X&a1F7vp*\z]O85ӥ&]t?;mWQۯ\B P{7,N3] i_ ,T+Z뵵^gz4Z;˔<{L}71fu?5x6L5mY2d$񌎇vw~k2M\b$3ZUVRW^jI/f~g|cu/ izx8/ fAa -=k?qs:qg IOkZ&m$vܧRMɟgB4p(G;_hyHHr$`cz[ZȢقOg{Iuf6G^o4WDʈۣe3A#8OVjMR|ZѮa=]qby אt.tb\JS 5UŴrآO˞gjoxb{+s~O=tBI<(5Zyn7wݴ;uMw>3}$H,jwF$:uom4RYWG{mOVUq,\{砮a#N^?xZ٬<#vߢ=wCAIC%wZ(#v]r@ Zck <16x|7amD R ;?ε|DeH(>As}~Is\ ==Rɻ/jʭ /f>cOKM5^Tqi9W4ָ3iwݸY d2x5{Oo㳎5(U_|CtconH"r;lcktIB x8kx8W2L ߏJ<>&}@}{gn\I3?M7?7j{g)lS_) 0x}iJOm;Yz1'Ӿ?[1'oVeH4b{$~`w|!IIXtU䘮J`Qgbifr&}_/yibum2;5A ec8=Wp{V?[rYWI@$Nٍ>)<*g,K;FG=i-M\&¯]Ko#kzG.ek U&)Vwߒkj߉_&&y 'pza@~G%Qil33UVXWRXF}#z"3 76|A?^գksH]FJP󃵎N_z-پ0)SQO%/iRi,i$ K~z?1oV)P‘` _qKw BrRKXtUXFw݅QyW|Io":}8CXͽ 񹢭5J[˱i:4)#Y=^3R-cAwAs\nV6*d Yo⣚Tg:i&Яn-exvMxCܠT{Wst]ovIQ#nu,v+lhDdv Bv嶅jMo5DxYt݌ccV}_]o!-Kt4]<$psTt CfQJ`qSiIFXxaR5"\q5՝;L gNNrGׯCPq?~prO}*Ɣ`ȅ,n󬽴S:2fѥncR3?{ӵWV!?#oZ&_-RP^89*z'Ӧ(`گڕV]EY%fhP\^pXe$*y c$ezzzcցjE?aqIz5C!M#+;{VJz_4om1q{=8 m=:w*#":1mg\lǧi2O*zLyKYשXSw߯ endstream endobj 84 0 obj <> stream JFIFZExifMM*JQQQC    C   " }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?㛇|:g>{hKwD2T-'&":9B^zSZǥixOIms_cKq̈́z{d~5N:9ޓiéx|!jn=%:\3)S9|[tTjTO,N38Q\, & vq V!9,ܱ ׾]xþn4vWWrǨ}kp4ʫxٶ6xxޣ64KW@gH6P9'I \Ѵ]NM?e;@x QkzƳ+FʑHpے/`F=c6]6]B΀L#mB=O>ݣZNu)I7e׫նІo۩C59id$6ъ ͻ{Ge9+r(2qx'խnf{3|bn+g/#^=1Q!?ZK)TKm_mY5, O;^%Kv5[fZwC3U~xC d=VG|m矴 :]QPNcm:s/}Z3/~|RmmGE$vč4qɭ&XIN\*Wҿ bc{°Z  x?ֹm'ǖz/-7, `dƧ{trLSpI]&߻y%p O帙-|x$*ױ ^GgImR 8Nxu?o6;NlvW9;?>ư:x|on2 F_4h;͚gXRM앭Vq{ቦm&b,WՑO^mlچ`n7ڡ;z IuhceCBwzmduWj 60O\zyWR[/qA jf}m>25#H[Y [0,10w ޤdW!y/"2W4O]R81D9!2:Arq_>Nem aWf8XЪO~}ϭ1~ZkFȭE5^y~ ʶXGp6NӴɧ{UBJ 9gf9g9WBV񥬛nZip 7JPkN}ͩ)i'll&Zƶ/ȱ1zrzĭ0^|vϧG1 d7sX^(n,foi5;WyOoxNK`im[Nb+ni6c={B)ӍYՄoUҍ*wloOk[;3F}>q$-!d9 |΍c}Ή bUmsICO|w>"f=<R B'X$mI9aF_U~l[=A>5jڴ1"?eyNAL5_y@`qX+>Y^dwYl$-٧v7P:‘1S "jeztអ:vDVqA`KW'pf ݽJNէ./+.߻Mhʶ1Er˱ZǪ-&ݟfE_P? 6-6idȅlK"-$1A' =x3U594)HFt>ߵixb}cV >&acFX5&Iw )#9  |lL`<Ljڜ7# )Icx[Bٴ6ffpȸWOiZ$lH#0q8 sɩR RWiZ8g[9m6R$h4jT簮K}Gƕp.Ɍdw e q޽f1(hd<sI8z&9JG9C0:s:FNψY x}%^Y 7+$,z{A\g![k 3tb_2<^0Ytjv hl3?0r8S&N#=73үIF=n #n~hv%eɨPjVeh 9sxcAoZ~ 67̩mb7|9hNs}#[_\Z npFp1>3'TQ94z~cH纋w_vI3bԱYeM1Ֆܧ..RFpp1ӊ Ku}%Ȼ&G!mwCj/.כҮ܇LQ>.ROE5-k$zvs^KW`|/s}IKRz{ۛC|ddMpW Ӝ[=JPzMN-xQm敡 }놷#{evhЮf!%E{$ӌמq#mqis{PN3l^jH/akyeR[}NяW~V-lZ7v]xQc+M}{T'S2:]yC}y?0GW n5 7Ph4.\"F,_[sK$8F)6m- Iw"'-#2 q 7dy;m>X<Z*$ ]"pK1٘rFq1?9<[˭OJS[ntl-qu@-s\KNfmN{R+9{JoeV'gZjxÁR85X&2z[xbAl 2(s}6˨Z> ums=VeRDјTZwA.VY6+̟h?庨?)ߎ+&>ٚ}5t`OtL8ۆ: z^'|y$M{s2b-OQj +@Ed4#ҷ?/<4aDdRA=1\n͡VQFK_M;V +c?(Ywգ7p[ҳ.*APryM-"?Z[9U9#sZOoo$ߓna/=dYZ,v(Ҕ\O\k4HmBn~lMtƍmMNO<T1%(D,n}{~˫)$_9W'+Sq^|'Ej[h||Ȣ/ fcXjY'x9-9&H-!#UݶlEV[dqqIdgIhk:&o\{$:RBՇkhu:]P/ʂSVi#8+=k _Nl&$u_xY/cs>rKyn%k*$s@=h\G¯ x\Y wV׮B}9bj*$As"cI'63v'pz_b+ eRM&KMA`u{=8XۻjѨSGRtl=YyeTc:ڭ߇WW=fþ'֮ch-W xr>S`Ǎ< r$N5 G\VsЩ ڄ[_|] 嶃j0I ѓn[ʎz׏\ A|LMg%}]3eFn8*Ox^ }u,˨EK;s&mokPmП. O8i9N{K!?ip0NN7\ԓ[u'H$cӴ{%"*0 3sN=XǕ{&+2]CuÒA<#hZڜ:]d[iV%'%p_xoQ:Lבcid2G^N9֛c=n5lH# cÂ𧀪IUJsNĿeR3I{DŽ4{kP\j2 ?n@wl#H2IຎϠ< w0yNUH1?+sW8m=vKTfU2'r;W1 z|;|nCu(UhoN +R_iױ\vG/]n?ߌ^:Զ:\sgV,9r xE#Pү){_-;B0}~UUn<9z!%(, tU{ͮ9.gAVko=^A{]1C#Y>𿆼/ɧMEg _-+\2p1xL> >^Ugd_+걔]BN;p}OWS>̛oc%Qz߯oSwcUบa H<=y_8Y:ifLv$ x~zɸo&?q)sZ1YZU җ.y}OŗVZ.幸Hr~v jCBYw *vGjذͨ<-LHxi>\12"Q1{Smm܈ 7 z+Œk[+#.bGԁP\[愤]lGp)2FTE+LNO'4T9F$u_myy- T(ZC .x, 5zDUD7 $_zd =_&ʳɻW<zSPU)^qߧFi1ĺʲ\[^^dzO"jPϕaPp \-z -,tjc$x5M^MEA'0"3ĮDz9v0Vl4%͑ !lA`kB^ΛN2k}Վ ʅHS{YF+{>SP>q O%O,'yփZq6tBLb;Anx@Ҽ?% k ib3KDV{ʺ߉\{($5163֧:➏U)T^f֜v_M@u6,ݡqH<+M< :k{ct3w/K+'B/?gqЯ ݆q23-u+=+Α_4ʇritQ)8L5iB\S/l|Rޫ a#.HX[y#5>kI΁{dz9">Ӆ\2ߠ'n/_̞ &O~ RUwRS|v6<;tM[oE _%t~mOڿ׿.< +"I=wϊ,b[y/8Nr~q3?4x>.8:q}Z-Z5ڝƓgi3%O4/V"xAV|| 5xfr` 7 ??ikw}(3 |1ptQbיS-IJl56-֏dĦK<׌'Ets`f'h#En1u_ki7:Li &qlN2ʱ^TӤ@.؉AO+2K/TsԖ-tb#QUV9a%ItW+w[^7{:-։.g ?:c*1}]>m GCOjہ}_ƨj:uy%BƑR ppz֯l&--)@'`cS]˛ڻoT$c앯}7> xS񭥝ݍfF(`ݗfcJ?h jA kK cĞ&u&3-@n2 s:nhHU/gygiؖcM?P#9e4J<ےK+7-)sEyIsctn$?LR,[&Vhu&M.+E-M ʳV݈G@89'tcÓ;QpH$qnuϓ8Ҭ[0kc9]j9ө/V;; jRYjxwo}Gn"&- g!f4I5Wev&wri'q\TaUI;nIwWq/K?י hSJg g5 C앨=(!S;*@ endstream endobj 85 0 obj <> stream JFIFC    C   " }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ? Sj6?h$}Cc?sduALK@`~I 7X̑U]i6`^<ͅ{+ʸP,% X2[jp7nLt>B2?-vM6+a)OO?rv4XܲuP:~he}rHW)?&hb"M6۔Qq@zV4v)/-PH+KCԮF<#䵑e@9դ(lӉt\>c3Y\@wv#Qq<ZoG"q?ya7l/7uM>BdŸqX2ƶ~dEdY: Z.T+IoZ!AE) ( (<&EԖ&^c Q4ۿ1 uAjSUgu[ew$?Y6vw=Ɵnm?J%qѓIeYqC[_Oz{.huhcP6FvWppTV/C+Cd;e=~~Uo*\&X~,j_.#l_F!Tj=ZN<: ̖;'UF-CASWsM +g1,Nv)7l 3[D"&a辿-5VQk$ n28$s G|~ X 7nBP0ǁYu8]jEh4+#+3|çp1qX,+(Tұ*- G RwΪᣕ'%NٜzہPL{# D U Iùp|BXM[Apj݆B.@?=sY|MI& b?8˷yq c!6n v"ebNNz^+OK1Ayq-PZë98{~$7^y3;"n$%sF:st M}4'tڠm^1ߝs:ok.̓ 36[h 8{q]QE| –zlN[˘#^T4,#onǚ s>^؞[H/fN4b g캭V@Ǟclz|ykM}ܸS ~ft#5kOd6쫌Cj1h0e`X1H?u"|;>Ho˪EwݾKG0=@5ͤެq:[DCWIʩ3ʰ53?j1mKY>HAԘ+E%ү l5VSF䙺,D}jœN\V=0nsKI`)ێ9XKc'KncUuSVk]~~i>=@j\1~l(Ys'aec>3*ˊfqx66d0lF,SMt yK&`2=A-KNkY[Np=u{4Ӻ5#N{jo0F:+ *r:I."FAVL$Eup$rRqktdL@? )~|O2XGk.~xFU?+*ݒ;|ae_ozxKUm@w4sDf_T`v=^Ӯ,/% bR+g\fʇCB'~|Xb.95]bI}6kᅃ?4M_zԡI1f~A5(qϮk4X놔cYΕKUΥxW8FG9BaG+R2#iqi 姕Bfoq[8o> ΢tmHnmܲ]}Ԏ*Z־5KWg-j:|=MeYEv+X@i; w^7+lrUqۚ EiVvdUd#z/.iV֭6W/USw!JxƗvvrI5ۥdQ݁؜glx7Si侹DW˝" b~ä3B9d!U֊HoEo'<U/y[] >DYc.q<`n"c¶G=~kξ߇[{ ,* pϰ<»7~.֯s]^\G1eG?s_c<:4{g {*w O8i&I.Mg$\oTW:W-8_^)]r==&(!i<"i"dV'- uޯS[}S3gs8uOYݰ'"?c\ ŽՓL?JwOQ5tԖq!H>|F־9"KK$'L_2IWŐlqGr⭤p=;/`jEmG"iRLv}'x;@L7`;궺v{iVWZOC$*cTq3lh38AjR O.v4m=1=i>qHS*rZ<+3~UI7r wm-^߹'yihsʶ /kZ3kgip %?m0dVӱRdI4U%4M.z rwz]'nmww:鸻0(=t爢 Tea^AoŢđN;\.~]m{`:פ|3ykv 1ekEnxuJh{jUQI r2 gj5y>Y/PvkK]m5-,s]P=N)mˎz~c桹5/?w[>=2=WdS{0'K8Lkpq)>T==Ұ|wPu w@;9hä="(svJeƓevNT; rk>c_groŶ?lWźw7WtD+Ͷ%cCPhe%UiЉ9g@H-P|V/PĎ֚5)!#LXCμ,x?8'8 Ai;FdJpv/xmakMf UK|9;KPMeA2#ի5͚Cj0[$)p}mI+$#i~_i2kWΗS2$1ZAGq֦\5Bu A3dv]ֳ2x1VKHUU&*3 5NJI֯AЄ)5dv^ZA\]^;F#:~5"4k1/gPO+>ƴ9]E_ѧN1I.m$Is.IJ*O-gB(?CR> ӟ\)_Ps'9^3U}B|%yoRGERn"yl|76 ́Rj7H,c;zͶXc|݌.{Re^I'Gu3~F c֮Qg'ܒ n׶F96Dǥn_SѮӛiN*3MOdRWsOA5 KV$&+FKa1G8u}1>k&$b` _voh9$ H uvZl*J7SgJI5~ 7Js-҆泅UqsjX,̬;l`rJeX`-ǃK+[\,x ֶiqUԣeqsȾ]`'Z\Nmi{R}zsBH܁6ݴ%:`+xc"nG\~QMm{WjF"mn M@8UhZeb6ms,1ӽ;^u9ٮ-*/}k_-igp첣` ץ*}}txʴ+jee~[fĒjL+/@$coigWCHA mАa(9>دh{Ǥ EˉY0ñrRmexNVk-bX-%U9Td*+C0ЎS##~=JaH<z]~v {W-m۝ kxXQ#1oW]o9Bub]RTGJH-ˁx,-޵g8`kJi-^ JXRKL6ĞcTT \kH>g o~] `ߘts^_d2":=:h1 p |v09g:cGtnfWWDm ,zc|vG Ҥ"@w]Ǧ3+eӵXTd&FOs qY3htd}+1\L9Z̯uo"3n7v8Qp}$}g0c>Y$+J;?xײŻ y\*y@}j -YǤ%e[ʙ|12y>F=-ITD)q"t:$URsp}z5M:O>ϱ=Ȫ7;c2tik"U4Ę))<`:c+[6[6x-]fշ?0e?r3jj oLjIgֽjr]>v''ݳyi+py0>W`=xJIY8嫳z+[r[A^ܞ(9`'tBoҲb#~O<0!ݟ{׭&|ye+'NOIIY*`ֶrLsg 8V?̜7rz=ԟ*]G̿tV)΁)ƲgDNbuK/^t =dxs k+k<{=ynVYC6?uҮ-jj={]Pʴ 6Rٛ9?'*;Pf; e9~=*M~ﹴὫw¾ԦYm9DI&nv qcq^zjc8-S k~[7]~<ơXw6}FOtlRQF6z Đ=⭈zl(ȭgd-2cQCZpűphEŒð+ (?@?Jk-Vh!pkWEѼC!7aٳת<I٭LY&a:[%ܶ҆LufUOVmCv:d=5~;pGЎEe#׆d;% al?95cuVK,zg/bo*~])"+r"[R^>Ӳ[CMR}hܥ2?*M_^ʈmGlt[ˁK ?|+QMy~BI끟ZY5dfx7M7׭ Hv?Ozzץ_zZ%9h^=ތV"_A2\Fs~] {$ʓ돜{Vr. 娞?ŸI>Q$.2=EuCJkY-p6Om9_dܧ 4ot5ya?(! +F^tDcO,sb{/qr d{1F&11 e lϢ5[ʲ/|\? رF(ܢX`ՊQEx_vDtm;{N3]2Y$ ďM]kq~Ӝ7<̕pzᗜ BO ^Kyki(<B ;I}tGOϪɦ\^Y{ E3.7+CT9 pѕ^Jj1_c3ZXԭUߛ[duS+Ò4[ea$q?}kҾ8]^~1 kC?oiK/ ㎿k菁˚]KU c.s{UGwݴp3ch7cڃZ6)a$@csϺ5g?-e_Ȩnэ͍OU(ԷDEbPUIM&e;K?l:th0@$ ߆ oFYb6?+&tD-nEgDH߿s[:5պ2Qn8/Ul ۯoxwNQb$(0>~aYztxb~ejw6B1Ѹ1Q.N$:Gr?lb/x֡oEH]PnAೢY2p>󶽨h 7/8*=<7BiFYb^d>MOJG >ʿgEq"[?4[ WQE|>7Ksi7Mͥ확1W)ۍ8<[6WQ_^bid`gAЈ>(`ޖiq5qufR {.]&|g^sc}\kp1HJ>T:]fU?.{(#-Uh?|U?0;6H@ aОMVr7{FV>Yۻt0ƻ=/M/"FY&>vVR:"uf,k0ipUU2==fvv 09hcCUƾMt. 9ltܖ_e.vsE,hZ( endstream endobj 86 0 obj <> stream x{w\GlpPC.ыB @^l1{{1vfv'nrWlߣhd땎sΌ`);YL}V@zRGFt j*V_\}JuEEeEŕK*KJ sr223rӵԴ uZVrr:9SI2ZHeJUJ!U&JdQ"Q('DGGGGFF"B#CCÂ|}|||32vWV픍> /?׿% "JRVV 0zZMe]}UsKmgWsWw{oo@nza~zv|uajmQ[^ЭuK+% isS SsSS#CS@;0?30TZp8ϝ;@QeemX#8hM$Yl6d Gd:HYL:GSD' v,T""]mLƥd &/*Dml$$ qr{y6LwYT:Q$i7|/E9 ̂hU[;]XY[[nvQjzfnbrjtjztbblrblltqae9.` LfaaqƂI$ml_)TP+F#_ID"FD@&SlH",G2hL6s5ٯS%+O%ImA b:w/Gok4B"1h4 qxkkk@uX,cBA-`+KK+P[X-" jg,,  Ġ):D% ChFБ `68"BgR wִVK2E:'5d #3ůEu!'zT  Hx"mM H$2Z`ŃA,px"_5B[a1 YN&LN 6[ b503ij*Kn[X]07Ȕ6(<0H0b D X%tg\.|@`k+ |>ISv c>ݘӥ_,}g홆wroaFG&z Hk$G,hıWJVE@|V9 8`مNl~x詒1˯~~0u^ǕZ_zl>w\]J/=hDJ1ht\tn7qb>BA{zwieagv SL|i-3i2XOgKa0Y6$ Nght2@O X 0%59l_^>ym(ETS}КX+J˸-;ϞK/A8@nRAp qb0h;T%šKa%se,e׿ &KKy4:ET`l6Y<aGW&m@2ftwå[tc~sMַƹ*gG.D\ Dodx&,hF+1:B ! )+nϓ0UC卵߮ {Tl>Rsb:UMUk4V DꥥjꔴT-iZd0x T*/ Lf*;MC;|8?];Սͥe]Z((2f߿ƟK7(=]Uv҈{D`@@`>BBCƒCBB"]ͅ3Ϧz]C.աot7V,$12E6JOU|v`v /%`1p9Ά Yh !҂I+#!niaG zw1 l`Ҕ=E7K1" z{{dC#<#"\a1ΉݛŞ>Tz8Io{MKy1#6yT}R\MQ$(HPAH_>qEb)TdC!PAH8 x2 qa-U(/m`*P%4`ғz. Xnl(* D$,E%'ckwOf/fr RZUA)@b.ſ3p&eS"`U'̔f& 2Dcu@C1@] %ṳ`D/(Q` qrtqpttppuptus T0wtɮj|N[X.jТ]ULj&N{vGgoVNۆtR #ZVKh R>\¤3t` zdpC`1Ar`EShT2Fszrk`ҒzXNNҨJ 9;;8  [ѕ+`|eKܒkfR>m΄ OKZQyj@Ub&&)axX驠Fөl8\IවPM И]0x3Z VبsKq L;0Ph@ӂ5GAOMJcVl>?zP-eujE9*ϮxDzllwi3ӲS Iҫv"ZPBt#AbEA֌@$f;KoG/D{0mmeb#*XȠ-Zk s4Cbe7/.tn]M_.S6;:4-#"-I~#͚bXg$8z!TL ;!nF3]-Q DAzF' GH8`4r@r 2 Ltaf^}[/zq /xt+S' vNT4X<-Ff6&d;fɲ=r|R;R=C{i&`Ig"哰[ٰ&Rf[Pxwyh 7Ww;w{<{{}^խ0m=z0 2q1eSG7vw^ybhTF3>EjCd,nd\`I\6B\W8Ӑ^)'06xdhBItf稤w9blnCZ4/W]T_T>n322Ҁ_!Er,%Y.Qjx 4ŀ!P&*eIrE\LR(Aje&&2}•'2cNr9^U_ecb[<}MRt0VSչQ9WOuPKZa_*Nǣh+ Wd M2 0d($ RI"1Q!*d8i$1!V+ Wh3FrWUpL⠑wSSQM^G>zLُ\۽<V>dcf1Fq4=& $x"j_*3"KvH o!" tRs8r JgT J2i2;a+`gO\u^5yο䜼(o;xyvlw7uVfR&`l}Nf1äF[Vb gx@D#- AAJӆK+C$ 2;7wҸ\}]=\v:8 ]؎,7~tLVw&slTGuگ_y蒦#jL6/9fW7VF4$B .;=95dleqx?_dNȣFTL!V1ΡZ7'WOW B'7-ţȪldySdS'f6_KG)q0axbH<+К۩NҢB*wbad<`PKG&ۂ$F!Ѹv<W&ըcp-$H[GttiS˰)FMؿ?W_}Oo\sc`:>>mfli]{֫̿!Ɣ~ΥllbTf`Ҩ4*Àh(HrPM:*SPlev4 L;g7H,2Ik0mq`&6VΝnQ%y_>gO鷿O_Q_4ʵY+0'$Xw*(|h%JHxZ4X1{L*D؁5LsCPdțx#މvUwd $!N]1fKԮ/$'.8O>㧟?Ozw_{ku 0 __C%'OEטMZ'[XQT:d(4 hODZB&i`&R 扣"#@#DFEFņG#cqq`^HR?{xՍKU X'_~w?o?G{;NS:[;O^{|&&6N=z:Y}-3''3#33=-gedg%|AAAIIŋʮ(R#T4Qe}42!29.Dpݠſ/~?t~}-^&(SiM=S3E ='_<٧O?y??8Z];Z:Zé{0-8Rp_=gϟ>gOA<~ ^S}|gO?}œVӐt/3坄ּk#kk3幅مٱ1eɒ}X4!/;ju{oP۰~G<'>pceoz~pν[O=y>~jDJF#2K~O`>D">\`+tr줼@9Tti_L$'ehҳR ̤}![Uz1"X:}{ 0|#S=EĔ 'O̎PBb\똙#H"D&S !ޚHPL; |B;+ NB A,.N^>(g GVS䙓vuӯfED,F;as<"#GFf'FGGǛ[mm-x Ѡ:ˢql47diĒw]E"wO?O@o['Yt!$DމKN;Y{t8qd1CQ0ޑ+[m:S( xz0=G(M*T9=2>=93;;}xx_\TFC %wttN4йr=*Ѐ_p`po`Hpx'03@rBe- q`O7K_kfyW۞Lw*U+ޛnkUǺPB3$,4!ES?^~>>ǭKDv[{3##S]-͝u-E Ml'ʴ{9:8:xGF'ʥ)*EZ: )>qsc:?3ٱX[[R'X(c(؆  DNj RE\|"ȐHw>?3;mint2'X$Oh¢TAqNΞ^>!!Qaq`7Զ LO.@,on/AqTBvVw@@TĄFGGʼn#2evO(HIʔ؄Xo»>{[32< ,.(f)Yq 11qAbGGW stv3'/0b_(ιY2 Mt]vupqX!!bfP* 0坤NYN}ScC͵k5M Mj>x7y7|[i|TJ'b'o@HtL\[ЍMOŃH^mk[\\X[[[__ނXj&iRt]zo*~_{W/7FG\?<.V_Qq>}?]\ܸZY7489445<4\e ڱٱY@;wl9[o{<|XTW[ Mzz`zcfH/C; (BlI41Ĩ)b4&bOc1f7O?wsۙ{~={}WodbqXkeݺچʪeYT'~1 fhpkxht೮),4j ܈^loqQ֖Ύ m' රkObbuXt,3g+W[9DW{g1!V_o?v$N:{<Ts &`t㖁ޞùLB.i99EQIsc{G{?]tB{ݮS=t/-Y\GWg ,/,cPoTZgZ͎Q_$JMu\?#s|? #/_tSoQ׏tw tuT==}}RA\ YRQ- m5PڮikJJ,+45uVF?/f(LV}C3Ct5Ffl!y8i6A/?ÝLNer 6Lu*VA;o߁ᄋ}۷:alrw lC97 #-70 4*"!+C')UVuE$/^6UzF3}D&fjncKyf03FrBYFdWk1 \ ߵ{/ [7uvYѫjml쯮j#Z@kϛ7BULLM-ӋEyI2B{yQ<5FerY~ \`_FaBctl~!{G,rq+* ߩټi[O *ʤ oOp*"+x|xU6\7 ekf_Ul'7Z%HHHulll|B|xd`@pȚ765ϜnfD\/[|}ppHYi喱m;w޲$E,8' "DžExR}Rr䔇^H"L.dY&00[ؖGfLELG@<#- {/@HNNXq|@`̘܅Zc`Nb=f |Ʀ\ 5Q*Q b9%ȰD/b׍cm  ]/Sܽ9%4434$78>Z= џΤ-lcT으ԌD3II @ڵ11%f|yO~gѱj2{f/*hUPJInNAff},g%rD"qnnN^^P_XXPTTX  3S#BRKD5e¼‚!bEyyR*niYP[[ eBYVUZY[$Udgf$M(VՌ t6Woظq͛ǷlٲmȖqvѳL;Aڪޝ.^>qW:{s.\:"xҕ+]r9׾qk+N9yꋯ>sԍwߘ 95 'ܸqӷau V7䝛oߺw杛N}0}|羹ͭ۷n޸~ڵkW^-WoߺvۻH՟JEX|Jݚ T+|{|<w߼ukr&^<{~̱?>呣9{ý~]޹s+G7m]Фolom.-+ʋK*eRYTfdMIODEDŽGF OrtGrS{5[l̐i-PAzf"t6ˠ)$:ɃJt'@;8ٹBaiegff06440]m`focB_g%bK_Zh…,7՞7-\—_=gmm80g9Zs̛7@: .[fc ^$V"ql밄~ ȵ];dC63 XX0305"XZؘZYY[Z,LMMLML_40Mc&&jcc쓭FzF007X @}`p7t',Xr:.3s,JͫK_ů96K`hbgG ^DZ6366772%65262001705715236[edkhdez 77Xj  ._`ezt\ahU4H/70Zih`Zw&:#]Cc=:n vۘ6{( +s4Q!5_}>!x|1yȉdMpv<OۋN=IT+At2`1tT7/O+idӓJ&QHD6 ΂JrX?6q8lȁ k'SH,I(do ;d@@N"y .nIZ̔i/dJxgv|.a뮶֡>!wFjE]ۅeovV얬{9p=rej2$"THm UlH'w"t89"*)huZ, 8S2:e B䙉E @C ",@.Kҗ%<8'CkqnAI4 ]cB)2M"4eH1UR!$F1<+nFG=oh)E=Wh7YEis#űdxZ1TɆ` !z1-Ԡe BD8F)bi ZT4hQh$0eƔX %V&=Þ GSxZ9&i%iL!Je@ kr.ƃJE6it1 {XeqAnjlY bS2!BcSРaդc"Y,F pR G)D8fѯ?:|xUA!=ș˧<%#RBi3Gi8L|#npw?;3}vN9g^L̩[ivª7<SN|))ow~DG~~ZTܼslj~z_"sqk,(z1+\vZ׋ցV׸!O׹|ßXWnLuol{ JdK~p|1)~|Ԗߍn**{I59_~Ǿ<&uڴs*^'g+Wv 6gsdi؞ԒmEV7\Ry݇r2EGw;P޻6ꚴe4~$8nٯM W{>%GVQ%ogb :vF:}G?h.*~KP?陯o,޸shIW #qޏ_܏}qFѸJ hWߩj/{\Z n޽XPQ֭~n>&鬠 tffo-(CĬk7hskh'&YJEۍ;qziudDEBC4"!CޡO>>{}h+CW۱(pɩˊ퇏BKߺh:(:'9AZӗlTc=IQyÇIq 3fKna@R $Ra?72ↇ5CPǿ=Օ9]z޽96Ʊ/&x]|_QQ3%'Ρ>dӾm 秦&'dě[|V|xnNM"8 z 3EfV?r/k'}KvjoxNOT+\x"p޹> A^bYl!Sg%ȥkϷYS,w*$*"Jk;?f!HLe.*ƻfԏ{ye"[o~vs C+M5IR#R"t8aT z~rE"P{h]r2J rkyEU%=s\c h KBJuߦtt *ܛ s"{9 D#  ijDB6rGN81446ɒ &GvyȭǬAbD1NKMSa-r(B4#7)\drdĎREp.A?I5͆NUKA^1RhZLF!Y2D+MiЋԭIAHŔ)r-zYAij*5h Ye ip2Ai#5i8GA@ϡ)4Yr-OQOC. j33 H\BVK53qyh"U{ؔ9*h1B$FnltX("ĒTX?@9 i ĬLR<@J,gvd G+zaՠ|Y<% !e6dx rv:gF=ENɉ5"%UI`IP{i`|R_JnbF_ 1qGdVAL[R-Oh*lݐPڷd@aV=V|z6-w!97vLEh3LB҄+R9\VW44A |s{zƮ%4/gf R:mxE0ZSbS_DICfDexnXryŽ;Z6&RkmUI5W*6"L靧HhyU*)ܞ2l-lq ѐٲYֿ't(rH>wOAYeb)R0\֛n(~uE; :&Ԍvt ׍:$wo(+ Oɦ63=A ހ'r_ʍ"(* 7r*lĸI6q=kSTv"cKܝ6"͞;i9 qN$+o E􏭗pːcHq!b0{0C FXdգpd8KNsWz. H1JE3z%PB8rkK0)ٺs0~[3]Wr;=GϤVv=w+4&JI,R-(mH`/\`El⁝ڞh'\BO&[AsٮO QTK+#Rn_GZ{9_o/5#DtG^fiOށj9ux`7x#` &F (A%8D`˕R A2^tfE| ax$@Z,Kwx K=/Jǿ [Y}Qi& /Eo,}Y^^\T38ԒV27LWј8KmXOi M>Y쬡'6/ U׷_x /`8`Σzgo{eG{z/u}3Ǯ:{ĵOxW 6=̓.Z^빴O;ok&QK!]SwuIh:XnJ9R&|:G,?aη{t2n>lVx31wydGh<Q5{stiNWsދ-=!C1߼qԙ#'#t-GP9-\rZlpŽd/-<᧐̛xǃ9:)!4a%tW7{uȳ C-iU5}ܔ1ɭpOZz?=34)H(CĭMUMʄwGUCY >ٛ%9 Σ]ty3~Cં+GwCa 4}a[x\]˙7 ~T9\9tje0W\hQ޶s?nj㓉拙GeT~m{T+ʭ} E) 7{qy&odrIb,G[X,7Tw?zB~F GCd0BnroCzNt7^?^}|ojwWS!4,orмхAdeYc\Qǡ[\jb\2aсo<4Xԇkg8e1 әWϽp-[{o`+uMYcRz%t:<_՟|*Vd򜄩 aU #K5|:zZߙkʲqmd^ONUAoឳf~z7^8+G&*3mZ]ICsgN5\\mkKʗ8V9,q޹ؾ%sQQloNaġ3H6)AfWSi]NLjl)Pd*&s$9E:ʄɵa=InV{dq7YMvݢ|Q~?#6%&"6m|21BE;!0F,ar0 0 U&Is71aL!Pp`/EL'f"`,c'b\(11VY4:ʔO0PcfՒu6&6@p5\ơwK+jX9dIT# b z Ih|Mc59Q'!'34_ęjPu2KFsR*QM{`ȚD(14K$|~eV}'V@@G6(GڕJ=^},DM0#0ˆ:kV endstream endobj 87 0 obj <> stream x|[T׾}sMrT&7s{sN1shLX0* 6.0u L (0{^Y٬Y{zׯk {6lشq ̕deݺ [DbBU%\*8`Iځy(;iѿ ?ҢM{8qV\-o{l{rě1K(o(|R{.ȏ) aIaoe{ZR\aU]VvY+/ky;og&wrBCɵJb\^s{>\n3V_*~eOY;CKqέ( $ h!+V\55;;[Tq3G>K;3+88WA-}al(:%)99ߌ8iSpRHĥ%yxoN{Y{ូٌbgx x)EYtVNW+5ӵUӪd.?UW 1pxx;d/*jZR*_Q+W!+NPjH``0-dժM~j:Zғ¢SD2=r%#=35XouLdZS0o}RĴxxC KrI%%E;sy2+;;Mt{{{xCYKR:N꣕άfjD~RԊ3m]͍͊$aOm­-Ÿ;eKTg5X-sgh d.́gd`K)9'*w:h( '=Ɨ?A(I~2xFP\Sr?/-vffS'sRI}EkEsWEmjRvu鱐Y>ه=+g]\j$3R7̡͵Q+M'v;{-!G<"·w B+KPv S#uE6(ԥ̙c-\Xjou(g{Og.HMJsKs>ZEM$;$%%= ~XO̥FQPpJKPklTwvE|3##捌9(3"/(^r_ʧk$ny sT֦֦Vy_x>TtqJ)N/T]聚R!PNـ O>jFpD ݕ+4Q)=!,vȇ^iq8~/} 1>UBQ9[Rqin1Y:QIyIK֊mW{(A7FF7%)kjj&&\2w f-wV}$xC%mkkoj SCD;E!lAʖTQ>U#P]rgIarڬ<QYX?Ff /5'3ɧR|h5^dpE{/e =nqkz@E=(ci\ZARM/ @׈فz@qo$&D{KsiknP]mF ԓ@ (e,j,@# P]4P6m@=G=Ph3jȽP()x;x gTŅaA( P;P G@M}%Oz yCU0Pcp6%3XlըkSO&GMl#v̇zg7Nfn}BF8 j$g>Q@nbeqV`-j7YhЧq5$=x{gQpZYxΣ~fQoQ5cfzcj8֙?{ r)řn~eרF!'oԣӕ!v)PCF=z_W=3D=:MPnB3i Q_7 dQ@Yg_& sO|h:\?ryT%P1#k3 T- Ti6r9ܿOܠadP"@yG. j8@-VQjzrGZy#nJ@45}ihGQ>~iHR%yv+ Tż]u06+Ґ]F 5kh(!\92嵵u65]f Jt76(-5# `]`zF U+mؼIkkGO2/iƼaPe.ٕ#=u~8Yw U#uHd%"j>t?Qy(5;~~ -=rNfR]=+zE+u'@iD0 *ř6F PmBEKߪet4( ά⪣(mA-XvFJGΖv% GD{a|Ы?̐/9={U[.o2B`t`"+{a*hpwQ:~!&EGݲhUc=yѾj"tkЍj ȝ* >LKGK} "Tt^Q3na BTASp@իW$W3vիq:MՍFFq~hoy=y^i 5`%dM%EL;|(rXQʱJB(-^%) + D{N6eEQNDX_ALVTʝΕ *U%wW<ޤjq vU(~^pS+_Pgd0*]8F@ 7Zy+jmWkkGkBzJT=D"_AOH~ށL?U)tiLIaN<3GvɳZᬓ K "^y )%[@>5֏=`ܯ~Յyp@pTݳR_M\hUR+T\IXcTх}rku2Gěv֢1Μr^r\t冥+3WZشb庥K׭QrE.*ġ_Iz wM E8LOt8/2ge|z?7gc޿x9)^KtiZѿDY,H^z¾PG^/ $O/W/i$//[e_&G-9YrbIΉ8}fYveW[|W"?$7ӨH[&JͲXuqQ/rv7ܺ}SߜeiNߞ>zicڕuW.o6 ?wɬ:Ikׯu^ѝǪԑJʰZοz4]5(+!Dj%5R櫤atR\)o55S)P>ܣ1z}Ǥ`g{w~7ȝ~2 C}GCpddf0QWow`G?GWwf xdlx`6wF]Czd6zLkd3b#S`Ǫ7~RBd2t^Tc21t!݄Fi˔н1HL/̕ɘ鱚82 $ZiW7"Y#q(@dtGo)3v)V~p՘ t; LO#7J#%\-|B X5A-w\ߎ2@TJUg: >Ȩ~P O ф[yeQlZLã4Q Tɉ&eʷzꠠ ֏8 6ԇ5v t2UU_`z7<61@فasM;st{qLd&9(["ƫLrƭQ@YFPo NJec*ZhKrO&|K,PILj3+} sՒ<(&o?e}]o߹s7^֭Giwtnn3\ =iAs`ȑyșʉ>ЩFVHb-(9}ٳ/\8/ EQQQAA+++ÇˋJeYYn]tNE**ů)ENJtFf@ 4СS%t~ߣf:+Ϝ9NQԅ T/^>'N>}\4қ];ɸqF!Z:iyfWθW {o5667]557nܸyfOOl%/<2.F Q8Q@=w{3؀ |<2?1#=I öB__I4ME~7I7@_rra7}Fs>"%K8؂>¡F=+&ZJaO f#u^L&l<Mn!汞fL4Wy4=t5;搛,Xo]b8Ө"#!KO;~#Y/4d" ُhK:$͹$鑧-^N؇N gF/m۶ Ⱥ 8*pw>| p8pz:Oèh5 WO>D(`` JgHw80AjPQQ[Z/駟Z[[˗/=z]a+V?w\|DW\Df@p{l6mڄ~KK -Z/Wb0b;'O^zU0M4ߺu+!)) [;vn߾wA/^W_}8+VXhٳg-[JEJ{thkPPP[[ D͛7㏵y||<5؀/0B3?vׯ_ܰaի1HD322@y6(GTСownݺk׮U֩S>ShC<_tΝ;Ci[<Hɰ-s  `YdjjjVZU^^-zYYYyyy1*Tv$rI&͟?a1110%Kd2y3a޽F^G (VX5kDGGOUX#}nhhxnٲ}b!!!(P%>, 1,`)HM(1'DgUc;sK0e'ɣJ<Ab2ѣG?i+XT@e&lj 3'3~/042E( ń{ cEؑEv",b! I!^d=qB,'lL ˇhU$c)%l} Aj@-ZÂjxoAMdv\ 񰔘;1EAp DCill$ÀsgqF',աCؑPNGrw` Vg0I5HH78T& 4`8H "( |/<<5:Dw @PAaj 8HP&vDxiDFB qC ju]D#A * +GT d -(3.D=Pf @aTx4  r@B  CEWY Ek6>ʕ+A@@#F}gP'`Pn:<; g CC1`*c-3F .>3믿ƒ'+< 8`qrB 5VL> =%  (o `SxX@QŃU|Z"F5 5;;W," XD"jYGA`Mx a`X5pzn%<&1AZh W@8A`Vj(PC9!a#A+$C\[E9<[aC P2%H(jΝ;`b}:؃qp`,1<Bs($8i(' ~N H#,3B@Мn J4ǃ3?ӂc䨃"pc`Mȣ qC( #>̉PX(V>zjmHG M46s 3{F' 8xȽ֍p e>//ɂsrjP)v#s1} ip?#Gy;F9`?U` p5`#T\g9QMm<.`;}ҠZph?w\~9b9o+dXcAW !ý 9H@1  >:bHcg<@ԄȂ!yb$:ȅ>\=f@M5*e\: 2 F8xH$\ѣG?#EdDcGtf ^{vx4lk׮E8`$)B8PP  *@Jɶ |kϞ=wl -}B'(:jQ`:G}p<  0!|;*5AKA 19˜a,)  `_,f Qb*vn H1}(>-l j Bt ]xRx48 z 報nl33PdQXehKF ].p%gf ,9 [* \P+J(60OX%& -~apb'V=g"cTXqrQၡNXe 瀄I7s΅&@i>,P =55^|9--WZZJ| Q޽{<Z?w E<22(m޼3Zl٦Mvܹh" yo…?WVV\.q_dǏᑠ%TѡP(XL|db~}yLÀmeBm]2e|]n+(>Z:䇆p~wfj}!kkZ Y_qnAF|J$ I,k wDMS&zvɮ32 ՞O i  endstream endobj 88 0 obj <> endobj 95 0 obj <> stream xYMo6=8( Mi>`!a{7n4r62qfLgr0`l2JkȣޑlQ:ٰx2Ae-`֚d%GLN[wyHB6Яcy üCPYၝp!ta&E7)f !Si4OC(2(gh:D "idž(=eT*%(9H=P!XAGCE܉T6C-wc7rVA# cHl/Aᜄ< f*%`Y~sd1D`K,?9[A90w;Fw ~J22Ɠ etP\9$́/,C͊bo0'0G&0 s]$0'i*ePR4܉dRB%!X",Pt`AAhdP7 P?tbXX Aaa i C)e(!3DVH;NOY|GA4OzI*y"7gW_萐A 6AƋ EH ENQn""E(B& mxEyBpYY61<ʠB#(IDh&-b&=4|]zp[zχ~u}|骿^=~iWfv_u"~%;Op:$ICrT\ KXNK%k,u'mQ5PQ|5PQr5PQt5PYv4y,q4{gg?L1!jbJȆGRY,Aybv^fT"IDrRLa=Myd 9P fGny:]Nkq4|r9٩n&3357GTDW*~C9(^fzڞ=k{YGCU3G+||A /(_P|AE/*_T|QEʗ/)_R|I%Kʗ/)_V|Y*n NAPwT!C*yL5ꖙGU+e T\)kJY3*fr BBsqH.?HIIɪnǣq,O9Չ,ur|nl9|Q_5[~1}jw+߮@Pk=&r}/tJ]Ӹiқjc"ӧ#,wZ̧YxJ~,g]7%i^G|sv_m'&s7ïf\onan~}iq6?kӌs޿ٯn fbxznk4]n{;?x~x^8|Az(O?^74mЌﳗ޽.^ܽnl-Wbj_o1iJѩV𴷻{ڰLm_/BVr endstream endobj 226 0 obj <> stream xTM0+|Vl!%dr臚ꁀ"59׼f7D#43o_o7۶Em誝šiPYǦ uSu* t<Ӷ=tr)yiUw{)(~;wcOEd-쿔'+B=okώ^z f羬PG,#IJp,m޳r-OwØ_P0шP'3F)P %`οRs4GQPESЂZ^yygֻN>}(+X"AJ Y$O#dA x $#M)Ή@YDм1D ^kwķ @ npd>qȑSx `d" 1@F GNV_a?,J9)Gro?_CPf似JxA8@ȗS,|(#VGiL604Ffkqow endstream endobj 227 0 obj <> stream x |U},mtIҦMӦI;Z֖R0"VP p_@IbDT\fuwGeƵ##;9IiA_y=w?w}(0Ň '.;w.ϫ(+o5<'b+&O} @vbyEO~+p*ωuS?ja7-Nl tTT5ѓLZ[j-RHۋ h?wS]T 0cYV ; 2zQ۲ߏ \>xAga|bTh+0-éZ~Q;΋XOcHP.=~vY ޭn`[9vVǒe˃V۳w,]Б;x@m叞uo~w9__Pw_(´ 9̧~`Tu/9fgBT VWXQ6I؋1X(^)2( Ph@mPn\v`zuXxk؋8zo~.N'~i qP4 )V?yXoAݩNd`gTK`ݩKǙ58KjN1m͐&N]9RYhg6)炓Q\ 'm阝L77,፡y?ݣO愧zȶ{ٙ]y*:?I=$?OE7TAsvn gp+`տe;Ďˡu.ѿe=/:;ݰvn a7ݰvn a7ݰvn/qbH[Cǀ" (i!<0 `LF-NX`3k= TsgcP| V$ ~'5*qP {lTp}ST~VHe(M ̓X$n}RY<f iR޿qXJ aX<:6fg%V+:v d<(R_{; ON-ʐYǦ }q{Rh 7A}Рcdx 4TK;}Pׇrٳfhi556MR;fRuʊ e㽥Ǝ=d";';Lu$YbVP*2Q`]l]~QUÎ6T Rooهbʅ'RJ@Jf19 aa3ѿbJZ/sI-1²g 幋*Z˱njcUN6tUϟf+Fu EgE|]}sE59E,b_)e?wgZcyYmbf+.rƪ,lGy?ˁ4 Tra/jBp/’0>lreavg דZypLǬ dou$h _;Ϟ֗vj׾mAkEwӷb'Nfo{G%@iRP6?r=]rj /Q߼ P-~WEWV| dh^Gag꒥\طR+f*B1aᒂ|D؛ɰP RD*%-&YCm;2bMT6Re+jBJ;y;nPŘ#gU8JtEH*>͎!o]345hfIӐŏ1:&̲U OGMc/*츂 Wuە# qiVls ʮy]^oWGEQ G.GcֆU(a5Me9ٸu;^vyM ZZS1y+iJ/Rzn/Z)V&)p{I1hHgHt Yqs~C/8u3A jGחr})\ĉL VS8h*H{O0Ԝ|ےSmʌfdr$L7K+'׶vU:[pچ $H,!2T鈙qlpk1_o6"MgpةLWirKkyG$ Ic VBFRjjoeވSR4 pKH"wKt* ?W;--x)tY(mEA e@`T5o ]MI@&wG[$C }@x?8HCH %CmJ$AxU+^&E Ԉ LR>Kx4)“'2%^#݄Ä]; $l%l!<HCOKp7.;(̈́Mo%Bo&D@p廞pZ&\EEWW. .%\B{Ek!BZՄ #"$GXA8IXNXFXJ8AX/BM8p&    y6B+a.aa6aa&a%7LNFB=00PKL!L"T B9a0%FFJHB1PH( D1!C&d2 tBEp̣G'tJ< LJ;!`#$VB%|BG@Q}H `xp(`x/`*GKx𷀩vTx& *ukTثT+^B^"Hxp<9g*Og (ÓTǩwS=TT.Nh;!@jm [ [ ĎGK'[;;qW v*@l@q;%LI6Q6#BPʛ 7Q u(R@)W #Su+ ]f偘Y1b&!. D\LqQ ېI_ꪒi$=8~Ӓ((~m(<e (܇r/=(w܅r'(lFلQ8QnBـr# (ף\r-P\t5U(Q֡ G`$ G! DxA Oe#ZK :Kg"I8p:a at1PBIA(& c(GQ/PG[opTF c#Q>@yG (ϡO(Ϣ<4S(PDAyG|N(Qn/W'0U-&,",$, '9لYB3a:aGh"xn2u!E$d iIcJpA$F+w ((a_CyP^Dy љtN=s']Twᖵ5U}lYSf^mEnoV_-|U1ʪW0͹UΏ:c::w.^T(yS Fu]N!dzNT*W--۲'[ZTRvh)rKL}ijz%O]_iXԻT$R[yvYbWe %{~` 3!Ns/-޲ȷ=߷`|_{훳eo{owo:n4-))u&oMrWTDwB,Nla[k;l[;CŎ +ǯ:^CG\RqGtD:kBk|x(fZIM/Nel1݋:qnnNxX4xuJ6Iъcb(GFinƑ$;؆a>B̓hq0)_9?Fsxq( _w0|7-Ga T{/Ab/L`"J"cr=-E20-IQ1$FsHIŢY ffåf"$R 1R3gr MAi3X.[,fBVF`8ã0.WbI:"Dxˏ]oYпL|wLP0݆(܎> `gA6oLZ":X]\'4Ai߻ͣ{eŮ ;L/9''U1+Zr^r]IyimԌ?Q3"]\1m\ztZlqvZzMB*콴q~Sck9r 2 c-܊WxZKFR7 |P7-cXl" |~ǭIWwO?5\qy-5M9kǮy}j}aO=&\GFۣاx[S]OviY˥ hnm}4W1t@xqJx<>~"  +)'x{*}d߹6¥:\E"ܯ_^EL4npj3ny.:%z}؎K!){&m"zVhlҠF#l:DBtt'xh;PHձɊ6s7>N-xCV;`,L5̥ a[bh>RKe4WMvlZ .%fKWB iLVu3٭T(Z?7C!_lv5,mGJJgU*71F13DgZx~e7[2`+z1^jw #Kǭde#ю24J6R;979j7Ȟ.*ONߺ财[{`FǛ[58Ujf.XrQ11,;8eVMI1}}Uܲ{9ٕP@sVV=4a:DU܁th/7̩jz̆T0{X;xAs 5IA'3P:$1+:z#uYM@0]rbQhmDmFXk+p4#mbA+ߦMUT >uwa鰯ɪj,d ;*C5y8CnAnPR>ofQތKw|&+EF9TOeCsR;M ˚Gǫer+[R;(!vyZܳ(Us+gfz_<J.x- MI)yxurz9s+4/+woy:-Fgv'k,_v_T Y058MxӨ\ Y^^^h=~Ɯxc=Xyz҉c+wj(v{/*{Ł'=gU}F|2j ԧq\˛gę{ګKjȣBwR籼͎*7=|B¤cPA_ɤPF!u\~zIz1RֿF#S.LPhƊdb Zq^,Bc~?ba~dBmxMZiWl*d_;<|B,NDL75(Iӿ1Zm7=®W^+DG_% JJ͚(yIqgF½pdB7c䱙Nu~:eF'\#ii0G}cfM!;V o"Kma{|fxR:e}MKiM)I)F"KwN1b`Gܓ؏ZX<%^fϞ;[zS˚}Nspj(C)Fǀx> (t 42i))io1Kܘ̜ &;vӍisK'FBP9gnhu⸉E-$A4&.sVY5eYMjqfifLBJ.eNJMtآ3|z+* y>cи%\썄XUqQL^s{XWd4L.S+v`K~]AQZOw$H5|PM&LyW̙2"UiKʈSinMԤWwMO?j̜P[Pl+j++ωa_wi5*M:UzfGmX7%7R(_{U31Y| w@,, >`N?&${UAFeKHFֆ_ײzO!ΗNnItP ᩦCMI_&$/ꞙiFH{t߷uZG6:mac0 :,a]ьlI Lq7 /ˇMB01d^ 62N+"O﷪{F#Y?VSU]WzQx}oTeQ^e/[R2#DHGbSXk㞻MeuT"zPczRF).[ƑY U>[渪g Q)"y*3Nh +7< m7HQljח:WN}S@Љs qNtfŘޯݐU77M֘y[>-*/^kϾjElqi3^]Q],Voc⊫7U޲ĚR=7zm-""9E d1/"O;cC]tm!:NhnuuԈ/<Oe htB01TvXh@/x徂6ҵ}-\{m`HM[弝$촋gVխn((!*-lZq&^>=zD[+Y6oN%DI`7*;CXqVGBx_^oFsZ^=&5l?$2>䥧'G""g]U9P1i/ſ`0JbxzM&StVBERaEBVeu,[d9"eg# ;ˤl 7SAeh-cbR#m<-/lc3I;SbQ)>Ǚ5YCלlHm⍳.FQX} S$ea'HkKfs#|k̮tk3[63 >22 qU?h+0OXQQq+2V,#33TD"Vt6wQZjkr=?aEI幩9ۿ)%ƅ}?nmHLo]Q~ؤCMU"ŎǪ s!iQ QL_^f캒4 e5% Wvfnop|K}kLnUU9/D[ɊB6 =%0JȠ6lF)ɉ<"tN̉ ^2dW~cںfuhu6ۺ b3NZbYCŗ&"*h{ƽ-)A/5%[{G+3ꚾvQ{)~RjK'v̰L$+֠ZK?riޒ)"!C'[Q{햕\[]ēEQsueC*A+ vbFTQݞrHTY.,v,1㫰s%Rł7;m&ǀ'Q%>cN(.M|5#3K,VﯴbN6Ye./֙vYU5%wڗo'bVM4PNmY[a_\*)`o%kn>X>Vj3ټ XSc 4O]cʆ`mUwPe.Ukjl/J(J0T?1?莦$gN[. jijʼac^zEOhmέIϭ͌h6(!whm-hc/1惐?1Ĥ5|z(W]F0`͟3-p щChx-=u^p|Z2ǟyt5GnrS?]l^]ymy\TUזߎ>55n;rǚM3?{ð,W t/=|6}:M>km`^^k%Brkc,O3V815rfӆͅӰ%1lmܱ<;=IIo~Uّ-w=S_[PrMڟgш֟2I]k5% Mbhb3{+M7L `oVwp3[oz/zmT1`-`2F$sсuDì bSZAI2Jai5y_ eXEI6Y#~+| \x h;x̘ pY!|KZCk؋8n=,EmAޚm|c\۹6,4w9 {GU}l.(ʢ3ZdskKyJYfdkZV}mFW^Q'(gT58mXA=2{~^B]I ͊MuƧ乶vlαۭV{Rt\JdwCcS#ryJ=GI5JO&XNO_a0 ]tΓ|+Xr$ )[zѷpi_ S +⛆SvFDŜ>~.tƄafOF`Bq|}A]͠3 ɒdOh ooh=>Z OzQW/֑Տsso~R,˭2+#pz̖V<^; mq- ~DY .ћ2E<|eugIiP(&$Br%Wn e+gr>ES>dI!R/,]A@|/~Hq 7zɖRjÏD:$! "C-\e ?{dqh` vj sI[#2EI-c>+)ߢw_󻀳챙jM{[O¿<+.Ls' H{7cax#l!#tٓ#B"䬆dslyXl)=WtDb)QSQ}\[^6#L+4s|qz6{Sy1$0#0$~[:*{+mbf36rbb{-aX_eܯ yy#Z9VjӉն#B+%JlEfk}gOW(KTf\300 OE%ކ$Qs9,UPRޖ6զAΚV[\ gzDMzVIY|TCb c- Lfg/DYּgXt&X9j8`tE>qx9i߷Jb1Y+-iu.+46!`jm$MUߥoZ/0Y,%jGȤ+/-K#WT$9 d9iw];*-^ܪ8xLds\CL"5n-1:cÌƨt}1i@\m oSJ x=dR$d%aGhSo |'9&m]p F&?mq.sWU|Ϡml|&׃at\([-txDC"E2f;rZvAxB\|+*KȌ6lȤxŋƨLE{UL8%acye'4hsIDV74һ˚WvOU//J=tCø3鼗eJ q YvE+ZZ+7'*[ZܯuW(ZmB"){ $-\ү7|nݬ7{|(}}$Y%!NbyҬOkD57vYj"Dc-IeYY+B!ΐgEvvyr% 1H!!ݘ]bTfTZU|{>DI?j#G{NAT*"Fk[$ DLk; TCˤw 4$7ZTI-< *3ʿZQ"iBQo&i{ z"d+/K򒭼d+/KnM( 1l6m}@},"~Lr;^' VgI;CcVKܸ `&,w#`<醅 a"]]hcњ&"ݴUpL9q}+8T~|rdLjVm^nUVdv^̄k&0c;6 =@  "sM9 ͓^F>*w!~&a3rWy8x3Y 7p P&ש<zy:\+4xH4;Gm1p/`i"xHW9@W"z76lg~ LT~lҊX}2H m----@mX%`N+sd/E+E}NxnL^ aaLk`Sp]Fy4OU#kk' QmܡqlRj R'N\\],՗t5@miQӯWj +|{<:M;Rq#,(BO(EQ׷;@FKg h"=rz5L*b/ޅA nnǶEn'Eo~v~[W-];n~h)9+ۅ>]7g=[etH6,^XKhдUC|>?R:Z0\?,ke:QcC|<,Sϝ |1~g7@=5B~1' 5OV#dΒ2gK{\;<:2<*p 87󸝛z=z vow!sD~s`¹tm 8Gdžv(ĝCήѡQw=~ttNX94epl?*{FQ#ðw;`przX[C5޿W*{psΞF3pvj{v;G;eqcslA;p?a(u:ww:GaXhA~55 ,+X]g339qavͷx}] {c]Ylgws.,ܽ{w/L (yZQ cp΄s0e;;=OOs7-u'h1Mvw݋n uGymdPgSBfg;{^"^%R#'܀~hA1B{xpgRܩZ]%<#c}WW+30ЕoNtNȸ"E:(J`VNDRD;~g:~`!!+-o+WZfcuG|X+֕@y|2l5Z1e$L<7b#_"z&]J%ۈ} c{9~LJZni4Vhn:L@mtOo}HOӃ8=DO'(}z)AB b)nV ĭB8 lGB9Bk o8 SxOk8~ _s,p,*p\x#8nQpJ^ZQaGۺX uq'8Nx8*8"n*apgo p28<8gEQz88]p| qv!GAc1 +q8nnpt>p/ 8> /6j"4a|p 7Npq_1p 8ςt{'B.= T:p8xO8 dzpx~ټ q :p;[Cp|g=DJ7c;8N7(8OpdiJD:,1[q;8x/8~ G/-pΊ b'n2qX'x#8nǝ 9qL`ozp pp<.1D ;q/8*8XAB m26*pĘ#? Up8>OpcW̥:#Upoqp|-1JQr8jzo5p~av?1/̞=1.x.8b{~x~|.#jQ$F]zx:bk21ކ|27^/'T'$1O&ܰm/EE0;˒EE=1;Oâ8tĠaVx>z =OxO,ԉ]B]L~nMUu+ hEVtgZTSόt8ϼ2k՜gD/Cy/>px yQQFWN:QD֎M\" iYo4lN嚚:QyTV @l81?`AƊzߘOP~ݴ0_"8+2.ej4_l(N惍` 6v#<++Ȼ$d%fm0d4c81:5 W֢$pq{t?Xy^$8d /vcE.~⃲@e5.?[ :59uKrH&3}sf>c F)G}>3p3S:[Ϣӭ&<_{U/ x5df3 N>pnjk8/u-̶Azm&ja#!K܉ǎqެgh=lsI)؈dA|wr3xV X$j 7Ċ繁.xSdCܹ7U{%iӴI[-2LA@TF*Q<#r"xEDtPoEQBA.uC4Mڴzk%-3:dgߺyZtΪ*r8 ~?MڪN8WWjq5-őu8(kh6ܳt7TW#!u;,?L;UEvZOf2 $+K;Ep׆H%RDL=lz9TDqVWRGڤRRsRs9˕%o]3=[= )EC7b[tջjDU{ w\Ty۵uᇷ[inu Wc l̐YW``3]OowmwWfnsggg(XۉEvZ3dB)t$ngbR2jQ QYTq_*gΪ0M٧WM3G^]n/Tɗdf$J͛gf_}qX_7@-.[ϥV 7>Z^UPR,7?*'E%Uz׾çO޷k{Ւy[] vgݑ;7vKO&;3cT7UKݪfXb$T*|,wɇݸVYʣk'USr]l-.U?`if+m%^2kEu=Q窻Cd9l6{c3)֦Z2"[ u=C'Ϟ4]0wsg5KH'fdiWK?o"[,(C\1bؐ3$Q]h? "M~t%<(u~ݢ___M4{ح_׃Kԯ!jh'ԫŮ_:ZN-u~]__ԯusw@I΢v_tgŇ=Aw1BˏGj@lDXEԑߵ4]ﯾy-sl_'jq˼Vnmی&rӇ{9' 'kA^*MyC~ab˸+w3V8-ݮfۭv2'fN-sqϲY끬SY²@ic"sẸMɶ"-նuMm-sOֺV%M_Z۲+huG^ӤO4}{[cKZPk-ZZuh,ٞlus4ےmE[n%WuN6GsjsN]A b-qɭL6\S?%7/ww$=﹢^;\NyCi;l@s]^Z΁\uvf=iuzd:{uy׻z>o'ۖ>}e7x~Sƅ7n-~kma>W?&woͭnO&dؐжCCga#:AmѦ =lI]CuOG s|vAq=׍h6b=u>2t&5cԾ6&U}ɏL.2z)lcʙ?%f5mY2k۬gEfmevٷ.lN9)j979ym}Cmr2|m}||{\`) ,X[x>ß//Y8pąuY4wE {N+|0ؽx CK.OZ[.w|}eiֹK~^XsWJ"/:4AMr%F56l`rO=wFiWgk*sO|eǨk3d>7&TbGYm5QY{P'[22㊃n{*vn_ܜNGy?%9/k}:۫Bؐ)1%Fʵ1cr98& r+l` s92 }?C}ц8>Wsɽ;{7ŶȶHF{َ7l_noDO[Ǫe[6R=1Ac2z;}!lqh/D? S.jx!>LaXb<a<O<  8Y""e8`$L,;Ek"o-mw m<3mth{T\ܑ:Dnp *K#"7,O ߉TP+wSŵμۯ},3'ؽ6v}=ǾD.uU0^y`̂%(m<"/m' :8h&$'Z '-Z܍gjdv֑lD=B#Ɠmdfhr7r#y3y;̵]l;N}#2l![J?ycU#>/} Ka9+Ҟ}lE=og{)QQKM; xGixǠ(ZJ#NȲpZ:09b?gJ!ΐigȴ3d2 Yd112&FȘ?o/?/h-; +!kdM 5&@ȚY kdM 5d 'cp-k܊T A3~ϠT5P@P4TbWe**sZ[OlJ{L~ŧ[w~JI7yY+e!|\[j 6g.J3UʜNws|q\-I= ǝ>N]^-ׯ1lւ`0 f\xR\rk}w_~vuTA%bklo7k\[jVV߲;Vf6h2W\?C3cu(ݣ`,ѳ|#Y""yIJ gvgȀe7(\S{);d}N@ |{ ~Hm.+SxjKh!rq𒬴}4oz;ޅ!`T_p>{LOL A{\֧up\ 9~ y[ ]@O>X_f|GzUw Rit'  Ash[V:ZB+h 9 mRh AACWЉ>d ~we_ DZɜ74=A!,%,w8?ZV gC= vC1~+rrRRRRRRRRRRRRR6)x>?| W[v }_d6nZAkȁ\eZ?(,/VV_v<`4_1lvlg'[/\g >'@N?/b9{8Va/P*_g=C2HIVg6fmgmأ_`I)Y%OeC3h92 mRh iA;hX3\þތC_IwY`4P^+2 .Ȅ,ȆfZ% ZCBԿq頟:@GUЕtg#5lF∣7Gq f{ Ua\7V}uS`*L:XW:EBX K8 ~5HqZ ;o񍰉}&32.duEd;0=Dd3Gҙ[/r6VFRUwr-z^^q29ƊTrm͔z^c]=dU֛xC)wXYʝYQXQ2`ۏ$<O3Ua /a-/+^oeu =YmX/7iAz+Oc'1ƭY9sG]O)))ҏRQJ?JG)(~R+SQNt'K0Me7fLYs0-bX,w8!BXRxe,F'cdlt26:NF'cqɸd\t2.:NE'bV:d1ϢnRx5^nNts/+ jڭv+IMnwݤ&}7IMnwݤ&}7IMnwݤ&}7IMnwݤ&}7è]Ÿ6Y*â'9 Ín8KTJQ)DG=~P(D'J?QO~(D'J?QO~(D'J?QO~(D'J?QO~(Z"^k*Z^"DTq"yHI"iK$]d%lx^KT>|D#*QGT>|D#*QGT>|D#*QGT>|D#*QGT>x>Dq(>LXx[8xZSKX)&b)&b)v<<j2~;v~o]&c)љ3NYϧ.\Zhf]K-.v.0&}0Ta3xflsa?C@ɹ@~d TYȈu6Du ,G`uY[%X S`*L0<mPD]uM5QD]uM5u"cda-$ 7jWv%jGŃh\Edz3uCT"(Ų̯%kZbLJ|(JFU8p 8N26QQ Q Q QQQQQQQQQQQQQ(G!< QBx£RKR!TH-RKR!TH-RKR!TH-RKR!TH-q q q q qqqqqqqqqqq8hࠁ&~&ƹ\8o㞁{)=8xO <8XO|a\ 㢁.hࢁ.hࢁ.hࢁ.hࢁ.hࢁ.hࢁ.hࢁ.ť(.Eq)KQ\Rť(.Eq)KQ\RdK.dK.ƥ0.q)Ka\ R¸ƥ0.q)Ka\ R¸ƥ0.q)Ka\ RX.t5.ٸŅz\ǁM[[[1ԍn ucCP71ԍn ucCP71ԍn ucCP71ԩGzԩGzԩGzԩGzх!g<Q<޳"K2Nũ8T\Sqq*.quhG8Z:quhG8Z:quhG8ZuX_UTAUPETi*Y|sVV ~#AG?ď ~#AG?ď ~#AG?ď (h (h*j*j*j*j¡p(C! PB8¡p(C! PB8¡p(C! PH5JG58%@7#DdSω F b4 F b4p\^x7b4`%s5cP&㭪cjkw/ker)f,߾_-P\DA!g- '}Ԧ\Yn_`{C:!kAGP>|#(AGP>|#(AGP>|#(AWCՐ}5d_ WCՐ}5d_ LLLLLLLLLLLo+P{KTI1 mha.=8D0,.aDyZV/jt k]Fp2t k]@5t k]@5t k]@5@NՐS5T 9UCNՐS5T 9Uat{F0=^^^^^^^^^^^Zcwh|Z~D&mv9׺Ke_ZO'2ev`-Nyhck>ǍT6;kpbvL X2-b'. O+[8^e=\+km}qGI5\.p1} a1<ʾ ︞g=dk˘]l߹އ'>;1JO8\b09UWnl +?Mg.e~eՙ2_-V,ã3zUT_T=UzUPBjiJx E( ֠1fAeAрS >@ !!(q&%"h<*&Bwb:iwHVޙϹΙϽ|?]]ko5tv}+~iՔ7RJ~HOXC)ճ&zhaZxƸ;7l`\͌k--Lw>Q[r8F5bF=yF$VGŹOjÓ&/j/j+F<h#v!78І' mxB;ІX#+gڈ bcIeMPx'3U Gh?Bj޿Zh'"tfrA{eּ9k.~GNuvO"ܱ\XRsx,UDxP;7fjTSLY㱼ơ`oxhnb47"Xv"X#԰\l^UX"K"Xkw`b>_ƹ尒`5F[op,JUO30>0r<u*'UR=( >fr{V#5Y Ux]w8XJH%uzYf{^1>#>]g&.dyGwys0ȷq*g2q:,dsXvn%?O!{*"+VS}_@ z]˱O@x;/y1hq $[M$&Q"v;ՎM} w/GŮv츥m^{xdZ@-Yxu: oDNݬ Uklh#9<^^/C.,˃_i'op|S-uP6׫5d&f5]5Vn7 6 ԻbxJ8Wn`;wq寠= r30C0ZPg0Q!vDgwq~|?8|yB'On8Ӏ9Bv*~ߥj@9/ DT: i@?ΟaU %GSɀp6 sv #<aF٩U;|zbP*kZ֩/KڔLao"RM$RM$RM$ l"ZMLͧiM\G_A8JwDw QD_ggk7kwoٱfֳ+w u7`'cǼȎys]"d/`;ޟ{x{οi?'^2B2VmrtKZGZǨNN2DAl`ddįcTvcQM=񦞑!^y'1;L'2bFbFF(A߇}@ Uv|f~Z Bg!O^NNNG;,尒`5mFop,UF|:B> OmW#܈_n#Z=V[|+_WNvp;B2\c'b:Y,Q? tP/J4(1V c*ZOCŲDIJt" uh|h|GD^$YK>~hXX=Dr"`9XN,Dzq^9QHWND UŪbDRX)hhUMt&:UNDRS)i?QTMT*%*FDN%%Dd JP%ѥRK%ZvdBD+UJURUDZ"@b!V_Ύ/gǗrv|)^nfWKv{WC<.Q7mM}:%deG`G`G}:kXBֵu-dDYֵ5-bMv֢(`JoW+E^ގJy^o^EةoVEت[]ثO>اb oFبx <92ǝ9<ͻ6ޡ7-1yWjY-30=ā(30::08è(ΈjQ-#e4qFg4aqFQ+FSSt[B%F' GHz ћћڰEa6znjzjlFmF^M!zojj#5fYgIbٟiq /Wu&'8mcQvy+j+kI'31Lfb2 eDLLfL:E'; (; w0לùo*L^R&]97G(u FvY[ZTk Uu*bbfbg3YOcc3q8XOkG9ത9b4mI D[A[!IhML'Y&ӄ]X&l61 c(f ŌnM0&#~Gs|t3 b0kJTc\TO0:U8Gc&no170 3/=#ص~Zo8SgYje1q)n E;:;hdz׹,qm:}E㶸r'fRDV*JAd?hRXk[`mXkյdMam(^eEMWG-h& 1B A,룬*X=Ճ̽ocbMV (X9fq!-_Ɉ[q kڕXQ0\+r%VʕX WS ĺXVbJWzTaF<~}:)4gηkW#b$:o-3q2Jo%rE'9 EO|Dn"[2692il%{[ۊ*j#6ȃVr_HFit1P @/brMBH-1s<|_q%w)7\qiclY?cX!]{lU+o[I(3na-g|37l9ғmp3vǮF^i3=4C6K36mƦش{6co sQ FVu:+ ׆kCõ1{X GŹ>ʯ%:=4WGs\q4Vg<h6:'Ήsh1w^| ɧǰXkFK׈_#;並l؅ a#6lĆGa6k}ZV$ I5 DN"'R! @NO"'ӓOԮk෼~S7p| :T(]0`c.p nv~)j3݌.a<3aڂ7o[-"e/Ksa1, ,M[kV}2=.Oj(#fsڛ  8Fvbc Wq&o^69xfbZ1{V^ B>cN2\{\ 5/ OP `?s1N\ ST>>|| >_O|~?_/ϒA8X#Ƌ/ygoCݾ[_j{zy p4 (Ta*0E ,Ta0=29w>G*#22x/8^.2:( (G#LSy<(lC6!%z^qȆIēߪ b(0Q axޭ1JDe^֒OU~b{Du׺;Gϗɾť̠ԣVԢ&Y:@=(D65̤Ȭ'  ] xI lC*Aʾ\Lq-䨅b< ,E"CQr4^A$) <X"%.bX".b"v.b"vFM\v]sȧixr`< ,Q]KXaJ}ZnYt/be;X~։me%b}|}gGZJNސvwki_hUy=^zzRoHOݤ4VtOLxflsaѶ:VGh[mmuѶ:VGh[mmuѶz1EB)v(a|;aTzA8jUzT? ep9j/7Vyzxxmmw]3p>>0v/c^ן VY@B+A;t@ ,v2`( tG<ORx֪m"]jaJw1K9nIxǤU_ B>Aڝ,T(,dU29:l4x~7`wn 5^eV@U^|x ^79k`- AZL~sMnaZ2<O xXEx ^\X KXaJXZEjaZZf@Z+tV"T;H.;L[!f?g Xz zk8M$~ϒYR?KgI,%~ϒYR?KgI,%~ϒYR?KgI,%~ϒYR?KgI,%~ϒYR?KgI,灹U5FfQƨYcԡCSw;ԝaw#ܝݥ_6G6Ta2X!5\5\5\5\.F gO&IdR3Ij&I$$5fHEAE)E$EE~Q|"i@m-oM6&W%W%W%W%W%W%W%W%W%z5^W%~Bg*Ѡ1tDoJf,9]јјєa4e?W|US Ӝ_zUH^GcjAqV*(C1~}$j;7c뛝JhDvbs8{\C/|m]v=P%\_ r.d_)R\ u;_TEfPٕAf$uUg<9D&23ɖQΎ%[-C(F1NѾ61!ˆtpDUŻ-]q߇wUbi^A$)TH;Y$6aRujiRYtOLxflsaYYYYYYYYYیkMW>PǴ2vчKQ-=[\Oŧ.*9K{@U}Oj~R6M^m6O\jdCɼD\_#Zw4HKXlVBO{R顉Lnz/8fKA#_;sHx^puWfpeWJq(J{z VCĵhnVĞڷ>di%3ntw{~!< H7%oE-b%-z߾yR#8cg2bf?o,ܙXzۮPXWz8b8=5i^Z}vS}ygV2O_ɎE`QTwt,|$Km/M`[ pǠ/ιv-u2qfsMOٕ`a|2_e\uܑY\8LcmW.O_dvϙt"aܧ(cNQtfa288yB\h#OFM<>=6fFb #yǝ`xLbrusqzt8>k$":߻=TfNx MK]IaZk3̴u;d}3U]^v;`'d|]2&m:Rǝ]GUI'd|I'Txf~6́0jĨs3+c]eQۄ1 y*ʚ50>y5>y~78} <čc+1{o0M}G_Rbl$|U|Pĸ We$`ܒ+զnN8^X8\X[l'g:G:Jp״tZխGGpeW^ܻO-Xkj=K8V ^zJ%#i ׯ)ϝC5*qLGJ7#8EKicQA+=k^g}cA91i]$nJNN{ Zf,uWdZud>0͘^fo-6j3J8W)窾UIvW ~oub}kub=D:?^;>7|W,t!Ї35jUgzgl*Aq6|z:\3T:m ^(ji#C^;+szOc !b8 pe63>څ?Gy5sn4GD=CAChž;zL>g}w{D?`pw3!;z8׿A ͎Q;GsY@>s1 ;kF6g,\3ku 8v"8G8=}C*<ڿ3z{}w;_Gܕ.n1#63p_Zd/D83J~C'Q>IM.;JYBGE}OTA+*)"" JQ)E"E(̰,R;䞔ɜ?ɽgqv߁\n0_n2ܿU:WN?. A'BXU5ʰ/ԄlnDmKW.=Hi*>}@Z5ZÒ=V8B ؕ*6e:֜B[X+֊؝M{أlgU ëWI{b٬ k:oޘXCބ5WXcތ_.7?x ނ5x+v%Ůmx֔ͮށd-xokA!>:QC֑̿b|>l4_7| &|l:7 `3!F$G*RqxU?,$:xR<ɵ$PcyD|Sx1t^P bb+lx]/ի/{ysדϼ|7ozk='Q?O~_b7_j_+ Vo][C|T2)2EYP Of"dM,ϓy(#E-y&q-;e?O@q|I$0V#H9R<,ߔoGhh'?Eg9MOt3 KΒsDo9WP(Eb\*r\/^A";Jb*j/FE].jL5SJuNR7j\kNYݫ[U[AlSՓ¨TWSϨ>TOW+^a5L pFQ^5ZMt5˫~T۽Zj'@|P޻=TռZA-vPǻ7  z  nnwmǂxAGK9=<t=^O y@`P0F{/cދ`R+ {!rċxЈ(oXj$9 y#"Lodh$))6{;:{?zgN={mmD}}(i}7>1,)śM~魈΋.6FFWy;bE2~~اvMt?K/7{ݺ~H*n'C^w)( NLսrz~Q׃YIߐ(=Fןz$)z+zl?kg\ e H/-zS{e;_d琇\>z]HaJXX3 ?,fa|1,C.a9,p, Cu~82|[~ē䄤IrFRѤb=IlnQ(61e2UfYFU`YXveƘq-wW5O>&lȵc~Җa Qz!#j֙{d/$9ǩGج3l[?#ep%0ͬõԼFEU-O\=p.l7kͪBH}_/|慔لwud{8F|3ڲ{fybDlY @_/E_W~䌓NJhmf JOha9, =5 wuVf=u ٽނ>[mu$1.vS>7oGmS+G#5KwZ\PjP-CUBs݊i_ТIr9!Ң##Th.=S*a;NDUΰ/>Ꜵn>Oܫ{<W7;V«^j[. wqsv&ص3EW;m8<ݗusͪ7"_EMǥ<5,3wy M~۽ tF7֬5=_Z?@]H|)=ɗ vZ Zԓ{7?Pk S_k c_XD/[ĭ4HSSzv~A ͒8FNS[\LK# ͶͱSרfOOOOOOOOtOL&ŴXh(d(b(VZQXekE+ E$2(biA:3(d6A$/(c !XNwa!bB6`mEXIkau`1z B[,gs,g-gX[ϖX~mmmJ$ŸHJKJ2io~szÜp 0 P7RKVIUZ5"4unB73P<䝏Wm[LIc敤5 f;^hҴ2tzYeKR;)?N; B;Pa:Z: hjQE;MMs47P!AT+GҠ q!"TEP9q+<5A;m΂6/!-VV{kHzkx;M ޗuz_},YNﳠPjSL].%O]c$\& RTWRW(PWcyaD8a@% T[)YT-jSn0uz2Q#qN=Zګ(1IuBzgObԅn1zg11!\ȼ!e QCIQ;2Ɏz #H3Jh5)cX}_~@}&D$5 BkgY(GTQ-PPگjP蓕j-ZS)AmDOnRڢƭj;ڼS. WwHߣ%{>_G|PBj?!QbG(BBBBBBBB1HO^-gфE@N;GPc b )N)_HX| *WꕔWUz5k\]R^QQ^oB| -z dꭐ١w SL[2~\=RL҆C *d zPRAWXC* ,+԰0eZD@"Y)԰dX% K#^&,aYāwH!p8-\(f6Y$bRR%?^" >'@1N?G=A_or>-@|!^apؗ/a_a_a}2e:싱dL5gπtA0vgٳfqNCB|#aC%9KP/@<*"TT-C,zEKD+[rX\."9o')A8txfWE1>/VphMZ,|e骩jeB]ExEeZcl߮nGxwQmZDS" Dk!Q L:B"uAJjHPPBQËB@[(鐱Q(,Cz `DA`D)`1Èd)# #^E!p$G 8tīdW3亼xˇnŷr#۬:e^e٥8gOKYŭ+d"b+yۃ?%>Uia$`S]G˳G:kZvX}ۛfAԑ_/rz(NVڥDKrךL \oc׻=ߛYfO~t䇙x_䭹8z׊f_Ҳ.ٌ0n31X)߭,΁xHv!&5[#=ֶ$WڰK8D_miW%؜9k^NMWNXVaƙ/lMQˑZ}N_eֻm@+26^>>ODL3,>8sR Y 0++|gv݊r>j3Mk3 [rR/6 nS &iS܍NQ}j>G&Og~V1'Tv;d]`q T4=Oo[mO O8q-HGGʥ4܍g7?v_Uv_hfn|kXWX̻ffjm1m\bSE[Y ew#V?qӚ\/sĎY?9ݓ3g8j_M'fbϮF]'䣝y?Fgp"ʜQKħ_ \ԙq_W^%lu=hqx12/V_mfۣ롧[s]s ;ohks"g>]ـ&5n-9g#|xlEe#QkS{\{82ɮ#Og.q2/ mkB4#`ӯlgcGiU~c,Ծ$_q( LBN^N2/ ^_JeBf;ğ{ks:1?%<p<L)ږu{7;HK'mLߟW';h ͦi:Ϧx-~>ͱ>h.o֧Mh?Bx8- h9S>6 |mT̿_6>Ϣ{ssi/>EHE(H_ 2/9@(+2PL/g|8_@BhREKъ^ 뫇zXUo75z?aw)~O3ٽK{za:Y/=úX/=?ys3d=3{za#gæX;<@w bAw 9H Ry #Ołb[P*(͟sx??cAvX/:ß^tx">/Y_:|Çwm0K֣z#G>*o}A?zᣭG>zY:KtxKf} ֗d}֗b}֗<ӭgZ/:|^qG#GĮ!j'9+B+,p-G>V@JEVJ2a ~.p3fUfS=9lV`h5VvBzg֓Y/ efUQ ֟D5 lUUVu[gglAٷt![!/BxW:Mr&9-sr[w)QI>\!r)%ȓN.s\rp{?K ]at1ѥњʊH]!uTIdL,"Т6@mԮ\n:b7ruuqh8B8Rsv.q]잭=Ow0 z * ׼){{ҽ8j_e9.sE0Oz~U3UL3 ?J  _ )K%HY/%/QFA1;s@fu:J߄6[JivFA]]TZߋ!ߏ@ɇ$RHH_0)ˀb2"ʘZj*,CRm$ 1WBT2EdQJYJ..#o)Y aiY%e _V|9Yd%Jee#!O+%-Ȫ(eu-!SC@ޚ&E. BYue]PO6"_^$/e2Rry9T6*[y7i#R]y|ɇd;lOc!)U>!@k;']ȧPNW%tPBw=p Lvn*P(Ru;CS:f:D ؗCPP#7y(apfʱr,/?FC!JH~OwDHN!9M~_Q ;#}o7+wr6d9h\9YC;TD. \("ʥ(m\5r Y+C~mrdv=rڳWt':Dx*@٪*D*US *JRU t*QcUYCsչHQmU]UG *5T T5q:jB>jϐ2Ze-Z kAւ!X Bʰ2-kABE,kA.-k7*7PA].dFѸ~C:G?Տ':^F=)$)"SDJϠrk5$gꙨ;=)sO(<. !HbD/E|^Fz9,evaw*K`蜰w }x\RrB5L)`teT2Q▉"%DeT \D/qL;gq,CqK<㔩S9NYqʌ\^|@:z'U⟁іq\[0WbKOHZz(Kee߇ NEBS(7͈[e6q#J!%cَ1tjQTd!* xsUQDeQs,)pT/ҹ6tǤz`UDC[&]qfCqfC˱K7W.raǕ3W>\6T:|Q.Od'Jǡ/wjqc:ެcV1++Ǖ +5H8sŽg;-1`_0 X9p=Pm]w !L`B%BB CXL&.FB{OϓBzB)eC)e)u 2.aa)RC]rxzx|8.RxOI͞{y[nҵѨeB*6 U[\_kַP>Pd@LE&-TAmz4 5P"jAB 4fU [o ԚY/].h2eOGQYf(AYf|!ŠyPM.Cq8j ԔӨ,3QYRbFg犟C,Fe*ÊE"@e. ԗP_2eW_^,huPe2 廊m6FMhPj Taυ@DMy5WPS桂ETQA>zTA棂<f؛0&ͷ|+oEVo%QEo%󭄆»Ӭ+uEYW 0J$f])Ƭ+0̺YWB1J(f]Qb֕ȇ(1 YWuf] Ŭ+J̺P֕P̺Ĭ+u%+uEYW>;u -|zC翰?n0YGG EÒ Y{C}/=OySq]D=Q{c =/.={ɛ"9<y2 Ó'OBKUx ׅz`>6f`a'3D`}agf؉ ;@1y=e1;9 p/9zKF/Qԁҥ9t/snPց"PA-Jy^@2'@7-nE_) S. /O.F} C<:W?P}!D7! C*:4t^_e\wrB9=S<>r΀Cxk Js_ySP!5?)7Ho+8g!\URy (AkaΣ̣\(^y[u) ĉY0ڳS0͈EJ J #aNg1G3{ٽ,iD̔ՒF}i֤ĽO}Zh$̝7zo R0R"fPJ J {^G)(c:?MbA<B;uAJ|]{ɫ:ǔ|L)) 1%;l!-*`vL l;m^@ #q`X"2 k C`OH "]hcU#mGw^C'-¼y$S7 o-V@Nީ`` yŝ؟Tc[Ё컀HE708L\о ڶyFg0YH:.`J9 OT֕ጺI~u|smWfםBVt$,3rq(Rn~yD>ߠؠm-WyKtWC)*]-7$6 ZCEGWQzCk4Xm)Vw!9 %Riy12)?^~ߔoӑ * pl^JMH 6{B8D"g4g7t547 IUKKF|UDU(e>0.eRʣW)}RS S Rm/wx-8.R_8!Q:qZlXD^ڭ;{nn5lw6l4_;}!P% )ҩӃV:wZoR4Iwz c:mo҄L1pP/tC=Sȑ Iw3t9GeG.UGuQ@_R %雎|yqRr-3\(<9*z%OMLJ+]V:RDPI:g~.| X] 6ԝUnUX7֨ MU&JG09V7&uҽnJ%n2WvMK*`suT }~2`U౺*QYQJu7nmݓU6E|H6Sh*W d%>iL4FC111 ng1 Z3^W&1Xa̗&U-B4]z-UҴ]ƪ%qc0.aHQ #pUlS*83J3jܽ_2zd.mF'p \bl>fl.3vT^3%]P<$\#GਠsDV2mwTٌS*񂔡*B)ոqS~E)k-[] ^\N}Zke%t$!+]W Eaƀ)y7@ , [)S._0%_2t_ ܗMO6Z2eZrott/U2f6LG]]2k>?羡*]j֤um:wzPǘ&i'ƶuW'|Ҝ #S4usbON7gA9$X}`s'::s\ BN} :3tq$q<4NuT>b"ӄ'B}t޵>n'M.Ҵ}@iM}jiMTMxdVLw]VӶ'Ia{Qu9ғ0Gy̱Y90'{ϛS=EAhUϚ=ǩpy+zŞʮ^6OOyuëu౫͢G_ui jڊ\}NARinFs:+5Ćb|]kU'=1:{f']Ӟsy\beRUWk )u@|Xg횭67E=BB=OnVY]}՝8Du%곖VUZ`aKkz̒X=iVOSY=c),TYJKKP7 #VY] hKpeZN $ZzJII5i!`hLHP6 "79=AX]|~))LhJ61]M2h,-4u"h%ODhtVcj5NriX"ʚ4"+MkĈIMicf4b|ӜfHLYgo͈xf\LxQj 5SbnӊxXtS3/mYD " \5KIXam\X +ZM Em=-͆h&5[zp]J%,EbtM]5`%j#NNj5IE8 tqxO獮wfZcq)פ7xǛg7椸Mʽ5Zk77o>SXEd o9{lG{ːUT`jQx6z ^'lYHTHBGV&vxi3 ۋ܏aÚ ԽC]5 iϚ twfTe8r{U@ {YKwV-ީQ*P3a=%]9oUC;\ꂫ<"]KjfXaoR,XEXaިbuH7kf51emn9af)ԬY{5ֳ c2x}c6/s,4U+zc5;V1:Awzn Kulr-}{c8(6Fc`Lt$LoqY>K7m\?{i 25n>xwh=8tIq'g kwrcAئܔLٝH|3z?w ^ujTDqNN=93$3ds3XC..:mR17t{{[pzLO tlcS>斝]A_yFǭ:{%vhYw=&;=^i=eKlҪm)͹Z-`l.ҊirQ:O6VZ-uWƛOjJmYk=fMc4۵6}یͭ613 ҹC;ikiNڛ3휭y΢ګۈd^7_޴Mm`,]jn++%bjɶؼTns5=۵Zb|v5[m4߭Uڶ}۵2ڸz'MצE֦6> Kͩ?KͯOg2jKs}ٵj|ZMq_iDw XSyYojv^>_ -ݾ>_gPvlxov~7\{o ƹ\M/kfjCW}s5k\u[w|k7VrpߊNf]ױ(M]=w[ߞؓ}tTIKg=[K5e ]3;b/cwOS}cv?Zq겋DUOHu'p?M5bg*=Rj~֟:>/ԙc>?Vo/ ~dt>Vuo ~pRc*[A]IwzpNLCw~Tb> ۸ zv{_w~ߏsf߄0g/31D! )c2%yL){=%"bdϐ'd ɓdK)d#B CHC B&1P iOI\wH|ш$<|=⽈Ol:ۈ[*͗_ = r㕏G3 VO?a?y/?d#&_e+_ +Y >$C? fDEŋ̦%E*{l#[#2@LxWqRPe (WXN+36vE "T1+łNqY$3*V+ŪbUP▬/%s+~ؔ[mY 핽/)=/{?,)/da azطþB ð' 9&Cbæ~G I ǰ尵 א/IX1w{ uG_zV8D }BI$G/S?/Ke!b}%!~LBP엲_e#Pv㽠J tײ_qoe}߿Bf(H>E&1x3!!Y|).$'$SLυ& G"޳هg2c >OS > b?|W:y{ ?̏4? &߄}=[]T#ZHݳ[JcBzh`l~\. ^Eh/ #8)o2%]n@햰cf [}Lh'DC !P$HBA(aU(,Ɇ@ 'P#G/|r/I>9x SCyh'&b&Ozb' Ӥ J Ggws_$s89&<FI #0y0"942R s KL+:δo`&$3E Oh`h_04DϦ)D tRw̙l6\6Xy*ԳUlikF03in H m5..r|+qepz(Fsr^k纸^Fqn]EnnqwAa~?IA>sK?W|%yy| P&E~_Puh~#D W|qH'0ʟ(ߏQFyFy4Fy F3q((O(<$1_"PR0_X?*z1_X u~?02q4s0hh>ќDs#|\ i1 1f49w0K02ǥ@~*9Ɩel-[K8"[:)?F!@; m F6-Bj4O0|ڣm> 3(>Oџ3GS|Ǡ'11[|/>*1OϥZ KEǾHY> ,Gb%r8PT"NY0 گѭ]it3g? hMNH1-Ӥ}sX| X:AS=gY9n2) [&1Ozr񳀿$i,7cY}E\LlYC[\Ee!:.[wAloݴ؉ۖ+Gشl?{B81\p$N+H^)F} X>ZL!;s9NHgAB8<'_9/#Շ iS M34|2}ƻip~AκX12m~5'kMXlY8"P2NMzzrxSlu_q)p(ԛV9GBi㡁Shn7$CR(;p%$ֆoAzJ%=Gk|Qw}M>-5럝+x.tS͕92&.&Ҥe+MV,Olu#* GUژ8FVO,(Vr.ϫT˧V`OF|Fe9*#m{&{mr_2GdE aۂ`eMg؁:9~c} U.Q7m=]̾x?{*A߸7W\}WuY':&zlv+_*'W!!4"TR:*T^:6)[j ՀB K{PZU . ֕BJB[oot>(Q tQh_h 5 cL -s]ҽa-(JОDY']y)K)g} 8^ 5%41AKx|09L O 3 #fgcoKAZs`Axi0"%5Џ7熷k;y\%u)X>\>)>Sw/wE$#vEFd;s9ҋ*x.ID[##ȨX^YYbde]#ֲH^YTn{ـȌlXW rDBe#Ue9y z*=qznCm} > T܆mq:646t )C:HA܆f6t(nC6t!c*Y}wN1܉wp';q;NtDD܉NhYjGw܉:q'=܆S*=ix4wǝ4܉@^ D+ɯI{%|Z>#%Tj&=j:J:RfU,QUjuMVu[ݧTc(?P5Tra1>@~3H$=Hsm?} _#OG>w;{;_^$DOIkȟ  F{М R ȇdQs}|+_oooooow];A|g}z@#1sus4s6 4e<h w̅ܕ0R1-]O-dPk==]kWi܅Z?SV~?_NUzR/Gs5%:\ *j:&V#O5/[%6$$ѽ{ڽ+iOz .ox7{7sܫھ3}D÷s[9FOZ[~Gtyc%OgL3J3IDqko7w{bOtFq]&orV'D _Cr66)-hq{s>锥A3,L949^1E'_܁[PU44=r鳞hzA΂&mMFɑD{n;u:ANEqS77#(:]"r#H sOEN[''f89GG_Clhl]om[lM}N=OV||PTPTJX\3&Gv@ir B⃔w[k)DTu GF=wߐo2Vnm~;yѦzcrJoFc8[lKyG^AhAWu.֗DŽk.%.ʱ]$j![yZe嵊JuTy t/®=ab%[V5ExR]^'fV8-kϬ˭բ]7S9j[Oyb[6Z)[iKc;4VV;z]G[Puy-(վƬm4>:Nvݸw1K+)'}JzE;W?)Wvq$K7on8"t=H~[[-豕bܱmgx˥zw.Kԇ\}Som-qM{7Sc͕brdlN׭ҟ!t 9,;a2[:oо龩 ˈ('hZaױAǨc v]";(9^}t(&nh j]pܶ &Wm^'Z1Y]VCoAjrx uEhYW/W۾놵l^{Dc+wqվ*|"A'\\\]:stTW.s.S.[Dtfu)c֛(ML"w1G}e&e'J~V l}MD)Q}l>V#ѶS6V}mnF{Vymis;k$ݶf]6CZjv}]~ž(#qi5N{Gq۞#lbSD\ iN럝mZg-w<1}K4(hQVD9D)tb"(@TA4h>Q-RDDkm&Fh~CDGD?O|Fϋ11R'3kON݉z||!m4h^?GX(JZoi* 1ޝ\D QHh_`_d_f_ioe2[{G'>{舧bq$;z:z;юlD ( Q8:j K>Gcc5hccccc㠣qt4;9.:ZNٙLtvu8:8ʝa,xg,vjQqvV;;kK+5͠mΝ=C#S^q_ɓbђDuE=/J:!y#F9/eʛg5-qAq!_\_\ IŅdBWB7BKo˃=liȢJY|Ri&Y,s$e9iYly] Niec I]z@щ")Nt>gwEO.TNuHOJN%t:Dgو?4V<Jg{T{:(X՞2>A{Uy-z4xHlo !76 %Ӓ)ɖqby2YmtRHx{-AK<+T[~,YvXvH,oZޔ[7~_~p>0leT/'TPk an kUFzR"'˩ 7CE{7`rh޶Ѱ\~!"!Ie Z;=uYaqNE]4} x:r?,?y)? o oy >SHC![PSjf9,7B; c?yC1_CqQ_ FRK8ZOBo7V4*+kX2i4nQ~E؇%& Wt%A0`2lN?)ۄ¼w w%!8`4Br?ZaUoi>8m~)$yš-r f=  9#]U .!4}vPQO(1?\.9hd4_6B8U%fϙ<&V7Mx @ .a#$_??u3!K) K o@_"xp ZbazhU@e {VJ%@j 57&V2zwΠ__rG47)Śǀ-aePn^YGp-Ýh楫CxQl`4c`3D7r{В#5! 4H40MgdWE?@ı|}üM^=̛̛ß'sKZx<[ъ1 1 쁑  x 쁹 d/Ű[E2?L5py[qs QԪ9 -AfHJm#>C {#sV'L&.&{]4恜7Yt`) 븠_ kX!pGx~;a:0th!{")B:L>GNޭ k :pɇ|ɇ|h584B˛a;Ah=}*a=}JN|F n:s>|Y1_2Q݌!9ͻyaF#i"k0uP ?I#ј.3រ0ʿZ?x|̼yva #[#ǠQ}l|*(a0JE"o=OCHUrKN.~+<3(|2ޕ5i*E |UG^^>Y# 0:xh)3Q^~yCV ȚO(߇^hŷ;|wa: 9OZ/1yWX\8V^m:ro>}.χٿ1*3y'k^@ViwFs6,z1΁4YaW0=o71HPihΆ9!(ag'` x8K y7˨ ˗q:ǰ{]獌s#l?b~fg0.XXD [ l- _5 S_`GX <柱܃}8A|wxcδJua#$dG1IJ8v΢8‚EGc oy|bT;z{ >F5P3?xNr}dQ>i\&-n^Zwxi/KL {pgˀ38Z pN7?ħfhclG>헱3h3h3hm-J.㳳O%aǘmra;hNЋ;-Ax Qw)pI.F2FEgg7 |= #r3"Ge%J-d~.!I7(dw̵$yJ<hz#wytY_I@| g|Q4%µ̣1˰V [ފ/!⧝pS?'8K+EBϼ8?xyQD1$fX6ʫV_r iyv9U` W|'@I7r98waT>[H {~Ks=௡/IWXb>̹-`1I5Dc]/&2i-C~IEx%o8_b=\IbGocO)k?BǻGsf,1? &ASFz-|^s1XY-s}ftp7-C\#T~~>0nc4:c4I|JԚ+4e}":N`?G{cװʬ\d##dFkcT gja! Xg|}x*۸䌁vl^qi/ɛx$a/Q/%J3 `:*2BZ{O|7 ZeECq?b|3´[Sk7x_a,??Ct\ϷYhbmO: l+?_sXXmb'lZ x7o`O?͟_Q֒,:l셓s ypY| xgyn(֨q 4/Wn+?YG 3tAmf:p->`) .[6! GTy6 \^|@ >6[?>oOemh\T~BYO[ ɳ|6mzYdC?x2&^7rQ>E,7=˽^Nzb։O8(?ysG5t#<(92XHcyGd^46Mu,=yNf#pg-3=hϋxW҅0dxVaNOПgas*{h ? y,Ͼ9O߀dlϘr.h ЯhL_o̯~~|6?.WC.n߇}GCr+ |X4k ]VH2i`}u^d%pjՃL)@ h$#$or*$E@?~Ufoo?Q+x/zd1|iAGD.݀G!|sc]1,1,^ӕE |"  w`_" ?#Eڛ$E>Z%ɐ #7.Ƈ'0xx?5~Jhs5`"01;y)'wT/l6c1b(CFr1iMxF63QK/4X ZNH,14aX 34~j`%Q;|6򋺷/Ug^fr:YtG=q[/oM~HW~ck I#Y2)[0u\_^dZ^1fc{wMOc%a{_^E]s:Ʉf1 "" V@ ,$DDDֈ&EMd .D pu3I~>~yީ~z̜dIyMs{/dͺSH?~̗EO58wm@amkY|(.xCw E$IЯg >700>X<_೨!Y[iu ?|Lޏ ?O)d8Ge{TDG<~aϢu<Ƚ 6C6B :Us%j[w[ v%gOM4+%|"B Y8?{,Vo`wwCTc!= y7J@^@Eh+,J;؝w?Fkз VkKxk -7Z5!v~ 6=d\98XX="?;"`yx+< V̇p$yQlNq8l>}%7:Dh }@xeCV{#(7za57o, 6u&%<wk?ҼW\!t֭A\CM𤲦c,}gv0( =9S, _㜆g$jZ9;WWXIJء}/Eş3ْ3:]QQloq3Fj- @8]F Y._ګn9V2Ig=˴),F76C*ca _JZQ\mm,;bC@F6Jɑ~a+XOޭ|r9) =:˥nlB_C,; ~DQj/R8|Wd!kU(,0ޚ>1,8_<.ϔ\nGA lLNJF<,.H~ 9(k?`3-Ec1"₣gV,;7ES,8he xgYExM ">+aPWbގ;)e5%Vty~PC;bxRKƨ[X*,jFo࿤sZ~@hDhF:˵D#w*22V _ xQB,bt=F0{ьp6æ#c( zn(uor#*5_ΨX6 ? fA~ )O߮ z ,Ժ y?$4A*Yt+4!Y5>{{al~/!g@< XD~ ˮϟOò#eG`o`* g  r`x x. .21 l:@>'Oa/ l VANM^ {Fo1.Xr{`-o[;,і\6Мl#Dr 7Ǣ'eNz@uC7yr} GA#j cWr`W|@Fzbz#]#g+Š~N=f'Rue/QvM`Aqto 1߀fŀa6CavCiȯC~WrFҰi`uh6C~VLAv]ȷЫlfm%| WUA4 [i EmdtAC` {9lMOeo`*4PjU;@vFU`x>EwEp?gt2sПN-hKnM`ghNA6DT 7@=}qȨ+OCy(<|%1/GsП%ƥ_,P%X~~ς   T@D[2S̀Py퀍` _= AF+!d!uH cDn?hm,%y2ւ5l 0 z?/} DTK@HQX"B$WTE-@4ֈ Rc@s"0 U`U4B]+w(m6 ]Q!sA*DSE h?bO|ljah?̃̇P֢.mR~wJ{D4%cq ֈߡzbK |6NFU> o2i wݿ+{wnw̠ŵhbьb0F2p*rk e޹+KfX%CsU5]j t^5(lNo67VdV|C`)5JB^ y/,Jעn|oτVv>̖Mh>} U!Eir#`YIg9QMQzemD fC86Y6! ~XF@ܔs◐A ;trlRQ5(}hw E cx9yc= ]9Q7EI&9w`Ydpe9mLW֝jKX!0]ȥ6wxyDe0E@f1~ {>`>?Ƹ}߄[Űȿ> J+r>{<:g8ۋRhwbR`F ȫtC8bxpb;`,Z(0<ѷ']%4aiB/gߊ?_X_׃ṲA֌_6"H`PU.up71X\^',[f+ٿhV(Wy[]hRyDx f6NMJbCsМs7 Q`,4<$ #%+.Mɘ'h+ +"B &@Fq4B&0 ug]lBѭ@9 ^vte. -VLl^PB>OmxFqe3V<_tc%ixZ,Hf?E]sbqGpB̉S08(})|2?Q| l~d2_P#jxƕ pfd.3l8I f̆el x^k9O;Go.v-?L30wڳe#!V87osp%_BR1_B+Пo JXzCxSWq}n7>pz͟Q$DZ Ovm̍&vĿA(dvl6=ɢJ{g'9(X_Kd؅!U~2xrcnb3d6ifx;&ڂ=wҖ8Dx"4Hf"s}8q5[MFaDBZ~'*8ף`*b2c"{˾ʿe{'pGwA#쉢bG7D* C/aՂQWy Wjz2~N0 n%Z吋VZ9NF@Svv+k  c]̆" }Ay,j 0;[Cs-o/f}_?!ZP Ѓַof9,3"lStrFF$jDҧ+4(CJOw%)?ES SqG婊 jD/P[YzޤxF/sEPUIjLm5D)Ri$~_P8%mF`G5eNoQgzzS?EH6l޼5kLQ"qQ/w9X^ /yT2C,=nwԜPGtMb}p,pp p&p.pa#w1pp p#ppwr /=BK+%'W llldR(  grh p0blh p'p/p?(drߎɡ[Z#&oRVJLF@s#lҮ{G ټ;S8e_oy;c_c3"W>s}1oc޿/(z*qtO*Gy.󽤝?Gy=cZy?&y rqc<6+sl*hwǬx48+벱vpl[ًiwwiH;+昅Jr8ߑ|g9y^9ߟ UcrWӾj98o靳XEcwS3ٶGv72ܼ+Q(Ɉn`֙fՄ3kw9OsѹH¹\!i4O2O d=%D>jlpd.[=/`?)Aca{,qF?gGB9AR} c?if7 {bɲ"3m_WC8fƞ1OGcm6AAQ%P%fz=܆dJv$%2$cYoY6)d2e?eZx^hQ Sȹo%uZ;mhiNo'vҜ4zי|Hc z߹\??h! "ZDDWI(@{Ž4Y#QF)hNSEKD?яV?AF Ci!Fz1N 1QL bCe.5d#Rl(:BNSRǎrxTv]Xͩ&NUשs9]N:8Fx]OR4yNK5Z4Dy@6Mqǔ4%e^yP3eLyy<$calaiFGLI;YѼkޕ}Yٌ3d`&*f$ff)ff!kf|2d-3̖fmyqnfY(4"Y|eOײ|#oͷYn˧*J60ߛeC֬z^66`~ϘfljnG|2d$3{3glisƜys^h.l.˗UsMsfl'fWXg.YLBEbEҢ4Eqvt;RD7J>n㦸)MuS))j])fx SR0Mi۔5e)g=)OLS26ULT3ըajQ(5yf+οőKTҴ5m7l:Sit2&$RYLIr&Ť&դRyG 3*f0U4CPdFTٌ2(֌6cPUyT݌7㩆h&RM5ljcfNcz|b>'̧Sz1s|FOf>5 g0_P}6bj`%,5KYfQcҬ& 5s536{>k6lglfm fNe[Le_0{Ƌ&~^icΙs\0d.抹^+bkrN[t&G}!M2vDm}tB-[c?c^qXY_TP#Bw{>^Y4f<D;)Ih 9ёIF&GDc8Fc1JpL|ǾqL|~oc_k7ǔa8cjETkcJ8cj;8|Y8DcqL~I!F9byr䄀3f> 0QȔ#Ff|023`䓀OFf 0Y# F>gǟ9 #MF|0U‑F Yʷ3f̬Y0*`什F Y0>`dCƀF6l,A#&#[Fl0cȮ̀Fv 00s+0?`@C#GF 90[0E7=`dȩ#gF0r1`Rȕ#F#`V퀑p+>3Q3D (0s#MoMkEebl"EvdWH9Jɷh|XG1y\&OIyJgYyNEyI^WrUpvwec٘l*dgRF!G"S(RT{%_'O)ZoQ.VU%We(DQ_Ub*JRA]W &2[ǿw(X{S2іQ;UiTo7FWݪGR+V]U!UTQS*2*ʣ~c{vMI$[V rLur̐F$7-r_1wSqQZayjer\!WU;Z~/ȵ5>[ζJtn.mv=j8{yK1pv8B=[)[4pA#i]ohwi,gW4HC?)4tA ͢Oi6͡)BE6;|EkZBR崂V*V6su2hmlL[h+m~YeeO^gs JC6tot~3ty`%LW*]tntnSm;Y'-xA/%Fˢ :xIt *(zH WYgUAqHGQqLwqRe8#JOqQ\qU\ qS!n",m bH+CR)q9Bme{AP9L#C9E~!ɯbT~+rQdI{^Ofɟ/W_!\enGUTY~UuPRuTSo]TiuFUyuA]TeuE]UuuCT[ l7O?t]]OOn&T7:N?[uKn_ԭKnu{Aw_gMwׯDCԽtdTOׯ@Ѓz~Kp=Bԣt~[1]=Vqz'IC=YzgLt@/ԟ/"J/_%wz^WzN5z^ Ao?Mzޢmzޡ;.һWYgUA}HGQ}L׿w}Rҧ}V}Q_7MoΎGg9zLӗe}E_עG5 굨QG z#jpԛQCފ5,j7{ xoyCo7KF{xcwd#o7՛Mfx{3OYާlo7̛x Ͻ/EޗWbk;o[{&omvx?z;]^xǼ߼߽S9wɻ]z׼ `Q$kU= JEzH(QQ0TÊ9Ŵ&T,QI]\s{{?PU鯾}/*YVV"+b,J؇#1}>c/2}ɾb_-}~`?'3b#9Sr\,\*W3r\E*W5r-\G+ד r#yySDn*7˛-++L*y|<[FV#_'_/@V>cLAjQWEPQtK_46+ţ{xS}""PL ="[O o=#\G^(`Df)Ӫ*V9v;I ~+9Wd+0Üf>Qvd=̷.2 p>B6QiR%5aFi#C).B~KvbٹoAIAO&Z֯n eŐ݅>e/䴄+r9Z5_ha@~}wDQ%GԾ;K#k<Ι3oKEIy"My#1G!Y,F&CJLSף 忉cg?ðU;9S])RiRx` 9=36 fGx7pYq?p9 ؘ]ocol 1+v!hz!PtGPDszm0BʝTɪj:jZ6z>kFl)k̚k6c-l ֒mSs9%w9NS}O e ) ߒcN!OYG^t9=Nb︙/2#k-p`<Pq:t" D4MMDP)h&5ͦRh5Zrj hObL+RGD"MN-j֋ZlAB!0ug/uGG?a} H$E2IKcSIdn.Id`+*&l+ɕm%{$'qgI)!KnI]}ڠGI@$+9){\:CRKiK\ m%Ǥ :IpEO gMJ;I;sRO'>/z nn$%/KCt4_HcMe-&(&a03ˀgWr'\+d}(%Y?8*]ŖRsԱ[ BV\A {4ڃQ$iix$! V~V>l݅$8 ACRG4P4$M4%"-!4N c `##7AM1Ma#cȄꚒjaȜ ->O!>!{2@F]ɬS24\0kh)#JA)@1: :SA1vb A1z!tO q&3 I9$c1*E i3;H<-=A6 {LC3 K`Jqd 8~)"G@ 0!j 89Cl?GmP[·ER}rwP.p`XFL,EwH%6)bإNd0d@l4&62OȂ)c^]6RԉX z2:=^KR D&EԐn0>#E8{m"snQn[΃hGZDL|LvvQ""% bHȈYFr& AD擐 D_ d1de#'^ +uw4[(~/>`$= C&=0kTAǀ%h]tt Z%zD^PCo!$iBB: (@xn Ƴ^NrD ўy#M}r#ΣYɬO>Bo,/%qv;>OwS"8  $I )b8C*T  8IpH!G"-a(`uKS6GvI3< \Ňq|_  R.Մ2ZB:`} h kR e?B )ඤۑ2 2'e@HyB;rLIaBHNxK{@> Vu<{C>w<w<w|%|(W DkQ.څCal7AO҅n}N.2VlJp.)ͤr Jpx;)RF❤»H9Hj$`c+2_jLCRRHMIY+5#e\(f3Veϭ&&[C|,xqz sH5Ik&-CZ\iq} Ic$VAn DF:V!ۗ[ Vz'KH_!BU¯ HD|8Mq0fz SIL*M.(Us5\-Wd2,f5ͬa0Gcqs9rʼn81GsN2/LS0L `OPHX*K----edewdddG'gr+Y-JYeae,YUaV5kڲ<`X{ցud֬3¶a۲XW=ہuc;Xw38uN>q/g k$C$ңA9 k'BDR!9L̽#uV6!ɓ!-It*HGU@c#K!b53 컑;D۷P7Qwݾw H;pw= wEX;U'L=0/0Ts? +<髇Қ2iGuҎ͉r'by(#?dvE¼n'Ԥqc/Xw j SDOSSSSSSSSSSSS ^Fs0b1O)"~J~*j_ViJבNғiғHOG ԀMPfțt =EL83ל8kΖSp̵q97י"A\4q#Q.Ms3Y\n>Kp˸tn%eqZnr[Nn7pw;ŝr繋e*w+nq}%Wsy3R?઀;ga$!; 4,|OI};i0!d'`%W?g;.{|}&YhZO6ڀ@A'!nBd_͝:Q?;BD{PG!&уƁ%~%x)ԗayQx7~ ╷&#+g™UPƵP(DJu% >2 oJNoBBMS(mP;)R&P7 r̩PoAYB% + ꭨVPnC [AJj%3 gȻ|HԕޘJY'Dt: t ԇD\=ciPNO kGR HJj<aaʠcoC+M^P? JsM@g@M֑PYRiQg 7|3w DF D`A0 hL4& D`A0 h;D`D0Q"(L&J%D`D0Q"(L&J%D`D0Q"(L&J%D`D0Q"(L&J%D`D0Q"(L&J%D`D0Q"(L&J%D`D0Q"(L&J%D`D0Q"(L&J%D`D0Q"(L&J%D`D0Q"(L|{[WM响{K[2RdcoAaڊQ4$qrk U=M~1$9 G#QhJ?ay=obba[Swf c]lДOEe(LQp^ޞh^n1 5ܦXA Rhj†T62:fĸ Uv*i(FE T4 =Vqc?Lq{FY%wh;8¦mo39/4fMGG%w0mӺgGkNь7E%⓱i4%J~Jjt jXLi=.c;hx]r#bݰLx.F\uj]V ]-賭ʉ֣}Z&qValqayz > f.XjAF>y^OzBM_G_=c{q/loP묇9u˔ ƨ;$^˕OO$;nD,ڠw΋VU4<|ʽb6m\In-sD0$ceh7&5@k.Iw:8ෞuZ>dd&4st+3yV5jնc;U My;+c{tbb|[ۈa6_dk?4Fk9*"q77 ^$N^i%R4ߕufk1cy ~YzIR$NCΜfsgRM{R7C'0cҁ^o߼NYAy;L8q@w6[/V7E۬κwDcrMc2oW;}[hU*[tsz_mMIW bws(e˥F nN 9 )?/{/y.|vQMUND{S ߟ+WdOhzk^3]6|9\nrOsQ5ߝ3EKm8|Zoƺ-j U|"}6PE*Q8$…RdiĀk==6i GG+ށob[+Y;D8Nწ]"wxVٙ+{ӭm쵵uKgf2dxgk{ 6@_@k'Nޭ~[\OZ6YykU^^{Y9V7Of*_~c8ݣ~WT;ymպ>,X8 +b^6M.xs~XErâ K_;r[ɱ^y3QZVfSu㵫jx-d:=7=WZ'!tǍfNP߆%fOtP]/ $MԌOݺ^yW{J畨 MZ9čuJ&]?6+n{I%v#9^=4;m5v,LR4+u4BGÙE؅9ww-d"ov qU1\=sR;'.mSN.U &l5b mNiU'e΋:!>e\b1smI37ϳ.(> >ݲ|Ff>.|RWv[kS]n1U3Eq@b=;gʴ社LŮOe{9$<^on5l/lCۆp:~-qeI拓Mq.@l1ᚶ=CmQ_(hY#FI^EЀX_L"(A6<-4[0Ai!L W@?;]f~jc8T>+oM㌾=_${ #{Yxŀ^;ܱΏ Itܠ0n._cQ궆N4}KN;>Ǖo8%J䂶ӵm Auijf Zsyur1p>༶0{ }J+yg{ŞræL^HG6Jhlia nĝ;ڥڪIgeW^wh'_ رrf>ss|FR]~ƨ7zμgEгqغs1}st2Uܮ WyWyZ$Oe^#7-\7}%\ŬenPĭkw5$MJ6aP‘;)R Moދr8_'@!=I.<(F_^%wK[ܶR]Y6`nm7j>V1;7/&r]ma>%Nl3%Nٜ_dǃ[?z` lQN|zMͻׯhnopzEk *-4gg9 } OHk9"v'Êϙ5:='??_; ʣ\K^6MQYӍ٭ZrQnf\Ӯ.?4vnӎ.6g}hCgWZ]>&R~5iN2ag Zkb,.ʋk39N/mu $Vρ;kG5fU>絫:ϓw]ju\JGK6N<4+jN/wN8(hZxuc/͑m&Mƕulslso0"ﻲ"{ˌ"%j=|̋C6x)l<Z&{]0^/\܂5[)!u1+nP_z+,Q~~WdukyzY-lo.ö/儡6z%O,0|ᮮʫ/wۜ)]jiіe}yh)J*xYEʹgx~aOgxfuYЙ_<.*_ҶN-\gжi;ïg HԪjȂ_߅_&XIhX 5H K]Lyz5/MU^[Ӎӑ*2=Vmm2b̹N]:m$^]b`ӣ3}쨱+z-Og)C%e;e?ewuڰ{&wi^Zuc}E>ߵyL񅤀xM>oz𽽨s+u`kt#<#ط/ůJg¹]J+ӹCR$v–U]n#T*?1o(w'};h/mܡTI9E WYx׺Lؼ:e'ppN%շa4+5}hoPֶO?Oq. YF|\n>&ޤ;.u KӮMb&WN:p}w?\tBe!2n(7g=7oM?1CbݺT+zklXZziR7' *[ݣS^wN'Z>17|?^/T,⿆M,,̲}L1÷M̆<Ӈ@ x܆|Ȳ L#!P:4\s2xwGA 0Z  E 4J /(de0T.TkPYK* Ӌ 2**&FDm kgsIwJ\͜k#zo<঵1Ik0L׼ri[q=/ܜޥ3cB+q>u.u)NaGָ'my67NSQ}ꢜ#uJ9=Lк/Qǔ9l\mzϞI# Wz,TZpZJQq^ӻ["Eɨ刈j<%{7q^f&& &&D61oZاdrFL{3-˰gD, -L,M 36R&s326a V?tY}̭KƯv{k{M^IM78’ 3>5Z_x[w!+_yc nάaՃ3 f8r֝ gygi Dz©Fue+s3r!:Т)=u |)8j7bJ,+>/wғ-]>ا4?Wv3Gا܅'[l^\8Rn/ϳ7m=gyzLh\ endstream endobj 228 0 obj [ 0[ 507] 3[ 226 606] 17[ 561] 24[ 630] 28[ 488] 38[ 459 637] 44[ 631] 47[ 267] 58[ 331] 62[ 423] 68[ 874 659] 75[ 676] 80[ 676] 90[ 563] 94[ 473] 104[ 653] 115[ 591] 122[ 520] 258[ 494] 271[ 537 418] 282[ 537] 286[ 503] 327[ 554] 336[ 474] 346[ 537] 349[ 246] 364[ 480] 367[ 246] 373[ 813 537] 381[ 538] 386[ 538] 393[ 537] 396[ 355] 400[ 399] 410[ 347] 415[ 585] 425[ 656] 437[ 537] 442[ 537] 448[ 473 745] 455[ 474] 460[ 397] 842[ 326] 853[ 258] 855[ 276 267] 876[ 430] 882[ 306] ] endobj 229 0 obj [ 226 0 0 0 0 0 0 0 0 0 0 0 0 306] endobj 230 0 obj <> stream x}ߎ0y^\Lh)PM $^dy꒬T=_YͯΟ~WĎ鬾 WjvЧDbg{n(ve9jn2{YwAF/iۛ{qLGE:}t~4YLao|+>nf @3ش6椣wOV{Hn/u8KjԜ'$Q-L!F|eLS2|m`ZBVS %2I#S̓ Q.@h>mM˄MZSք@39 &r.i񵢨Em@PA]js/"ʡ~RUHf,sВHqQtb CL%Q{uET8TBε'B L$^&.(S/5%bC5/5Y"))/}ګnhiF aQ@C! endstream endobj 231 0 obj <> stream x |SU}/K=m.iiӖ^([CZh ZJ,DQq0:2(踣"븎èʌUg6siJa>{}i"%fn7l+JJwG=VZTS|^ KJ>~[?(Ұ|+o 5!#z aھs_9RCu˖2**j0"dnV@z@h%+ =n\YS#Gh»X Lϟ Z\_ x!09ϋ}'.q߸mEg|tW9Jhgt.\4`˱?5;n(mX]›+fAOY* D|Dst<σ?[tC[0F¯[UN/9'YN %0t %'o kG(M(^A}*U~[0ռc#zJ UzqJfg4e Y[Vv-mc{@Hu|uw1. ~Qh/OM3}AZ* 5OR{pLCb8f5ƎJSD%Cw*uh˗(C9JJ}.VV=u';;pmPH2|qLg\o f[p5V'b;wUiQճmih}7 1sut;JJnM>O xZړZqgq372Ge@ଆ&`1_DZK2JKxlݭ%A^i,[rp5~giwӜ>keϹ&iF5;:_>l.(±;\bk,b3*lexqKr51 a+91`DL*I"/Z\a7)H,}'Be@PSvrJ;JuJ-!ܝ$1 W.FRq/F|Pgkrt88b>cr0",sYnR|(Zq\re0n;+ Yv\\e9(n twpTv44H}ڴʲ7լ(= îlִ`/0'Ӛv>1 O(E\_Wp'334ߓ[Oj (*m@c%K_ iMP*WΥmmeI8mbJ_(:X(鈅7@jV7]ѦlAc,;yCalimRP%]}&X05y[mhm7TTe!Mn2g$*`"aIj ߫|Iʓy)v`lScL9XI/{vg}WS S+pg᝖jRbOTن?W1&X8:"\v{8η ip,;pbCs tWzZZў+D;DTBO+gw!~ǧ!'|GҾׄ _}S' $b>Dž!2%CxE$Ax7^_ Bx eK /L>O9#!K!dDrc,nB:!""R'!9Hp#NGEIi#X 8B,B!D3D-DP # #h "R!%)9AF @ #ÄCEAj}/}Go &|E8Hp93§OS{8G1b~s =»wR~s- oRo^F%U**˄/^r'd(AyL}Տ҃Cٌʃ(lB>{QA.;Qr(Q6ܦo&?GQ֡\{kC[AZ5(B#!8a||9^Sk)aȧb"B'a!<¹sg c 1ф|B!C<"dF'Z?:ijJ!(Zjg: >(|)}PEymPny (Bىʭ?d~#qVń"$PHH@C6";DQ띻E<"@}@^J='&j 5jBPA('J %:o#X 8B,B!Dhd?(P(ߣ|-7կQB(@ُʇ(w_By?<ʳ(Ϡ<ʓ((ǷlCي}lp!,Bl>ae.0NMh#ffZ3 ̈́&™3^B#!&S.(B*!Lp7AND@`"s22 uE+k(Ay;P.nozIjo6^\{ѦU^qWU6z{Š 6VFTW,شܫ^4*]#t-k/*wvmzK uW.!bzwueK+{lZ-],v1۷ Yڲ81[l)3,\Y,.Xܴ;e…/ܰ^P،wga켊0%GE0R9hgyo4mszg[37xgyomv7ygMwwzdd׺5U o o]+wyK|+>A ;W[:θ}q؃8Q.k7DoQ:L46 FU> f8E?K>mֳͺt)Y:QqѹZSgh S5ZѺ4f.Zdk /(3fiJ`xEv-)Kfq"K8LKfua%fJYNUh8H'5;D͚ ``ݰ`<ß SA+\G| q]*Ų~+_Zq(8tu40)s} PA*k^@A8$x Dž+TN',.XJVEp1.+J mq1_ k`-kp&nA; 4 nRyp7 w]p܋C# DFw؊>x0 {`;<܁ Q؍~܃}BqM0~t}xqf/K2rZ)OixU sm/ ^76>g݁oaws}b>I(;R'R {>B;&aލnȽǽsdgg7Dya`~'˃!{<2%ĂsE?wSVrxIADZ  5%ޔ;ZuȘXeQUSLRJJ[ GŃ ~ 6n[dRS3-F_[O&_<(/we#D \hȾїчf +@3ZzNf4aOpsshQEr݂a?z+wt^/y PRRaʠ5uO$dXDV~ "'XWDn8ѽlꓟqta[v;VSD#ytm޴7`}[ֶK춚mLЦ[fNsY>r埦}ߊŠ ™TT\f~[bvbkи *8[^LSPaCw32 }>>x[cjZK=E݊4hA *55<^i\ZWrVffΞ?6kC{F\Z:lheʘ2gəҹ75[bQ1j{=rDgZa+swi}.*>B鈉K-8/Akp'M/ٽ[zzUg_Ͻ課璴~.;sT:\Z\vG\jp6NVGϚ)3&\+,hTΩsY0G#O?lCx.Ykv_ g$i5.)p `e甈ꠎ r\ 7 <,Fod+z F1}"{5H.埠jxuOˢ<} L\6A$%&k%$z<: 8.j&j'hje9e̖Y-}ofZ,B=U>P+FC,wNNn5IR3dEFG=|ߺLcڨVbf.w i?N8#?0mJ|\QRT'*qFZgcυ@*/+<{" Q q*{NL.Ig3 -U{*K@Oy h1l $N\ N|((ftHLO\^ 5ޚ$)3NPRR}fa̜v`+αmjJ&SrG!9gݔ˷t=5K2fIyv\*vuȃ[- ɻ(f+$=[UGXdUYmV44W:O( ߵW>>ϳ[6Þ4P@|J/XvQ[u{ކsGsvJmq9T.F܊crjsr8Gc U[^ꉸQ8!_Wq^UiUYFVEp[ R[ v $e=p{ "Ӎ N\Ш7ʭ]&L-6ӭcwJ6GM:~-JDKϘ9%guWWKS.Vs(=?e K-ɍɷ%W{TQ|M> εܒycn'NvBm]LNvnO*szbZx`I{R7H-A&ZeFO =0O~gU3 Ұ(oOlp7,_AŃLdٶmAcg`JΗ&`2hNe>T" iKoY1n07[qhrLJ W٣V^iUkL'Nh@D(_c/N<[Y~oW-?3m_nõiݚgpvy~&pׂ;eaA{9+ïxsDOemgM2Qk:ƮǤi5YIYmx gaR)x5kdNٟrZ5')1ۦٲWd,>z1:.%R5ee!*L) ^{"с+fxDM@A3{Tj=9cǚр[c˫@bPpj!YAvFs¤pFs6ه&aSKF5ى X>ڡ q 1_iTy&"0B2ckΫH=tӯqqp2DiL,nr|1V=L1RY U*Miaz9eT~^w-w+A6<\{gfϞsur!I=LnaCQhB&!#d Qz֞"`VGm=C'*j 3[k=Ġ'#߬zZCv}MB'-OӰLBz/(JPPys3X`a늯Q|؏#Ni[ӶD;o%GnpwiJUk#i[?^-Y1beYR\ʪ+艹gl5u-wi<%݋c8 h;*J"wie:e7zWFջѯ7ڍ†`]ib# )+^dEz’;$Fk')W7g)Ֆ=|RBgδܘ{n\^l"7f-(Y('g-,̤v%tBk`ud!#CׅWu,S e&Y្GGFBh[IH͛hɨH6VZŰ ud 4/֒Y&uBl_qmsvxlv3+r; rJ\I%rZ Q^Yw-L |~sm;޵S_V6(NPi^o,}RvLO,Ywʼhe9AgM^X^".[ZSd⭱ er )ĜĔ|19f}Sh X SsQԍ7LPFϘ?Π$Gbn,J*H[ЄĈPmOQXVc-Џ65FLpF0:^7^܃:ș OȍgK&ϴ',֫*Gd=1LAF@ -- o[FÐʄGc]rkȄڹ,SR)Aqӧ1rY/ziFQsZjsq{lIb;rIj:N(LEˉ-Kҳ# ɣ 9,/AxjUS%{V٤YYuSX;a/[2NPR9 2 u쿩8XAblvhD7%$0,֙9 |.֙2dyxj "gZN[`l%7e~&o lɗ&WJ_!P֭ Ce׭BxㅾF@#$|Dpx.i˛$x*:^ gҌ1N0.ʏϵEKJ0IusrlqLjrum\6{lGȊaFQ@q˛X|4풳IĆMyÎI '-XTz"]UrnY&͖?Or`!R=eaOyq:3iy.>sK;e;XNR'LL5 ie|הʓg1h8COKs+Mܼ&Sd™m?p?ʳE@r}-+ڧ^gNV[v [$TҟJBjq,YW2M/><{z7Q.Í1Mb-wpxњ(:ȘRl$c'ɈO*մq\\nz}JY:#R7Ib8 Al&@G%K+!IqVR^ }" c䷜.#&Y^=a:x:`O KE`v*bob/l:Own-tl]O6?ŦTO]3C$ $hFz+[}q 5 8NmffZ&ڑMޕ]j^m˲Ϩ,l_U(wFUVc~ 'cKu1/AO0!}w-@}^vTLɣQi7il+]o H|tZBρ\8=zXU&oY4ȵ 񖁦Ty/<&/kk 1},UySoc3fo7<(. ,fD6 #03#5Ӧ$d ɅX33m?}?dwn-JxúXF5ynX"k=kɒ,;kL:|SϐF D#x8gxxe*H\2šed/XQЅUv([S W3uo,ҵy)$A 7 2gi*.^2ZǦ;gns٬+^8|qs܆(aӔ5ĸٶ/(Vhu[v}iʔoLZ=8):9 ;ԤY&sq٩2cI%Ӧ'f\LVJBZ9:k|BESk*vRM<_:yp6cM2̘3b$'D(`l M8f7@f\-SY Pwgiuʻ`k`Cpai O˲M8ۆqV26l#2QDr5J)W#_yRx0㡙5g4RlWH)"8-8r>,,5L'W:ww\BaX7*B; $ *=w aWyϖe8~+5Пtof[xS^]=E!r6LɩF͐q;OGB#b-yLVGjywymOoɿenqG kW3+7_;{u32M?YΞ;p?~@]{5g-i硒WO\^JBg-҇f> lRRr૰OKi:Ew@{Bx?1p~~"|j!oЉPr6C!,.hj3N? AoT!@Вp 9{eЛCoNoM~=EO0.v|H P@cWPQmQmtbuP;:@ vpX ҃>z t 0hR04Y5M5 BtEl,q47lR"UarX 9pP;^kQX<^9cץG9,<9l`r؈\9wKN9 R/xmPrX X9pT^+Z摙o:\KyP,C9l.9lDezxRX,%?KaRX,%?KaRX,%?KaRXc$T$-FNT<y mji[d\ԷiɡG""^$!n|ljZ~h{>ߤ$ /)HZ02^mC^a6e'ip(masΗ+3vMA"af^ :H%? 4 ZB%(:'4 a;꡿ո5d HO+7X,)*$.v{Z>qV9[[l K\ mV˹^Nlnu4xZDo]W|gXtu&۶j=m-g E} pgCo4x6qOlly%:}PG@6A &4|N7likn@IonO+4\&hlvDg#8epr@]zjX΍ 6QZ:6/7l=upc]&Հ unVN Չ>Oγ`! u7Io8Em9u\ |>͛7ۚlPns7u[[|^( 7AI[[9b*lڬ9,rI}Yq/|:[]m|pz.xqBz(ⳉJݭ-Х9\y=iTRx℔A^Y/1'\;!bk*m@j!wnnqEV mZ ch|vg})rt3}A{XVu= Y4څʑ qhFމ =ҹW\4APz R lyglyW )壣<|"3Sd7:Y@W!)_JVd5քȮ {؄f)x k/ [QnCWq;0wc#ދ>R|Wc^{f~oSU%1e58qñ0˓`9X.KnnXK)`, *RXZK` X,˳EX^,k b ?*$R2,,kFX,' U:`y|۰$LR Xe)` l,me9,,' `-`y \,1 1cfRXep,XL%,~r7`y<X,/-`Z܊2,+z Z ,*``y3/~ثL`,e.`8b,dU<,.m9 `y\,x V8dr2X6C,GS%X΂&f, 18Ie=BRXՀ = `yE:8b, A],,?D)8d@'e5`,,,ˋ,`y0:ä1),Rr+`,w` <X~X+ {2@{i3U!: ]Ziu/|󭝯h9v_|¹s4MNlփnbU3X$]=r1i4VoQ""Pk/\Ҩݤnn%E; +3g$\;%gZ2F4$zl.ܤpD.HꓬHsqdC@M/ c\Z5 mg@SYMHv4!FrzJDznxat"A)ZTP"nWZi_r;loIKEq@ 5&׀ZY+ r*=+x 9R-)5A !B'h N ^xDbPC4? (BmJVdtG\d@fEHU0;e;R !K @j"#LeH#4g I 쓊9B#ԋN!#ZJë1$01o듾}s 7'i$+nTR$wR.iG }ߩ rpԘ# θi˜NN9- G`*L%ꡬQraNMOm)?jzzPT)6@ 0'5@E}  jO2ݩؓn6TTPF#\P)s;efTINbb8IXS!N#81KERDP҉Ƭ hLl$vk9u`kpP'`GWE :u ANUhzoKs<¾ANtP*_:-)|RAΠt sXϓ]w/q~ҟ~K\ʍ{H6adXӭg>tu7w"Yap'</Cdjuڢ~: _AQvŞ崈¨lJ@ N?v >;=坎fmJA9wP/ G;kMtzAAѪ}r.lZkiX]ԓv>87`O$g=z#8J :;߉w;vNG>2!^DsHP>]a!_N* 033; 쌸2u>R`@OB$=ZkBWVTjKGQ)啖sd;'V$dI1ЯSPy D"25JzZKJJ е#N`! SتlVVV0z^+Uߣ wKxSC!WvJQH+谠̎}%]0X%%WWz]d>IAc˕ڋ=ݵkO־R_f Km`G Wn\iiG06S|a:d;H56pA :WȜHW Rggᚺ*-._9 *|ۡiPV)BYŁN40ؠV^i$IrfX^AB2b*~G,N* _܃Y ]~Nw3Ynb:  ; SFƨe~c9:»jo4*7!dyuȘt U *FUe9!Rb4,ar_X%Er@l1GCМ1/L }TITN,FT^U~"kbXfR=PY%&庩tGC i=h"YOJxWOԒk'({ܰe/c,@gz>U*,q&r? ?@$BA ma3ٶ%e9Z+M,8qOYHIPU,G*NTR0}jOgDuN;Leyhz~r{qs juJW* [0ZNͪ޿Hbr*.bY/B5 bb$ye(Wtҕj@'!;k4T jPi?{jzYVڲkrGsW_7fvCkݰ{CoӪ&D΢Zv mTMM7K>4xbԉ_Ǩ{U/9[ɵK+h'cuiǞW['6pN+ք{yghu@/q=h?}ath{QWצ:ˍ;>owqc秌=٠ީ=v~:ܵh{=ޙtgKqS>1᤯޶}%+=[Y <(o|Lַے+Li-s&yo1u/v~O0٥W[Qw^S9wWk5X3o{ϚbJi̼ϣ4'1q3FWoDTx2nJ涒&NTncvGr{>$lϯpUmJ+NdU۾Gi+JNUvwVգÏ{ǎyVQaW/^JIowxvʨ{'TOdSz 93nWɾg{îdli-zs#:JMk^[%Ai?Rcߒ<RqS*=K;)nܗ<'zwTFk({pd4Q'쵒}VqD̨dUzuIg$h=M$;-Uڛy$׻#2ٍmvGYң'Q:L.1d~/}\s,_Ee',KKOOӗ$U:ʧO QwUzjXP^ ŲhN);ф=˾ʓ]yz獨ܵӵ.wU!ޟӽ'k&|j<4=?-Y~=4!<MLMJw{7MhOoUeQ}h6wBGtYD#fr\fG:\p#n³?8ކ/P)e'Ie">=}j49}ZT>GU~髣= X/_hCkxkƏ%x+*w Š+|hO'<V|B Mm*hS=Ц舊';QyP48=_ـ3p1.AUQ܏ =oB6 Vp6fFcGF#3RQoOGڗe˲m?vll.NmSd/I*W)K~T\hg 써: LF';hUhNn3~]2ƞ?<ޔhNTp\`F<\efeXwq1~o e383sq縲a&qf&31w7&4 fbGeʹ7+nhI՟Tl;;Tމf{I~|{twtuG#\kq 75Z?a)a9V*F֢#lutb=!6 5`X؂"_B[VmB,BY+?bB|eȗj!5Xv?5t'l-śx ylB `1̥|-<&l< JX_uϧ`O7Cg[޻%wq+=_k_ >TǞ[߆q4qpg{YZ'3Ɍu2cX'3Ɍu2cX'3ɌOhZ]fשujCnQ[5En֫v5ۮfln{j4AnRyuIgDY^ь3cX;3Ό3cX;3Ό3cX;3ΌZlWj]-S{[:5N͵[2ָ-c}X2jږVڭoN:!;Wor~"ۭ_e855lJ^j.m}԰NW>,'W:V6XWwjN='\U{ݛ=kx\މ] W>Yr q.%7$3Ncӣ JwfܙqgƝwfܙqgƝwfܙq$wIcp,>s<E| |'+8 ? ]e^܇/Kar_A`&[ }$QVɞRaCU T #QԢP]+v ]U1c1;ޏ=`U_eU_~4ɾP|w$r/twsMם831 \[Q5ypnK0,tHq#CRI/Ӡ #Q!K&b78GNt>a|CaHF!(>I8$QOh| gg9| "q+8 SBo*TLC\.W!.Wc6~kp-o6܎;p's}Axb.e~S5o9y/a1Z2DK˰Sµ_''Fr\+ur\+ur\+uæ'$¯4~goxaGy4/_Q]hԈѨ¦u[]qwT]ݬ3 s0 ][$̷|uߺw=`[aU䚗?a)a9VD|oxUd[tʾWͷn8T\?A؂¦z]1. Ux?=v978L=GQ}U*UF9FHT(c>dO.̳<̳<g>uĉs<)}U9IgǑ]u}}b΃oUU,{9ywn =ޟŮޭahdzGE#tnuVcaݱGɤR׫ʮҾ;vOP=V!b85}bo@%{>rpxN}ԗ 810Z;EzjXX=:܈p3?Oq+nw.܍܋>܏ ~r(mT߆eǩ#ZS|}X!׷ֳvꯅ_ǩgWq.¥6b-[,Xlbb-[,Xlbb-[,Xlbb-[,|'+8 SprX/5Z*~{~괰 uC+ Zo#b/b/bo{[*VV_T7 ? ̫ռZͫռZͫռZͫռZc9ȁFsqdPAU32)6o3LZU]2.2.2.4r3iL#g9șF4r3iL#g9șF4r3iL#g9șF4r3iL#g)E. tQ]@8} Thr*4cy&io>tx]=dx]=d{qj9j95Qc5Qc5Qc5@j4P hF5@j4P hF5@j4P hF5@j4P ԘFiԘFiԘFiԘFih*BArh^(Ӣ4z>OfmVС~4OO)?%ĿB+ĿB+ĿB+cy0cp,>s<E| glo\yǷq.E;3ш24{aqT.sS;V4;)Oގp!BS&Yq8}rJvig>+L gQ?~L1cԏS?~L1cԏS?~L1cԏS?3x8_Ɖ Nq67q.f<| ۸"\ P7nLݘ1ucԍGU}]ex>ueE.jhBs2ZhK}O"lef(|X‡%|O16 *` ؠV Ďuc/IQ}|(G>Q}|(G>Q}|('e_}_˾~ϙ pf3g83 pf3g83 pf3gJVަԒ[ Q7i.mNmYZŻq=)[tr]vw^е=tkOu6BYf隥kYf隥kYf隥kYf隥kYf隥kYf隥kVN˩~9/TSr=t{{Cнt{/{K^ҽt{/{K^ҽt{/{K^4NtvK=#[piPj0nH^IׅVhй)~+wqe /rb!^Ri92{՜lEO4:k⾢ƐOJTӻs~QaCmCמZkBԨF~P}ϳBOW;ws7c|ߩչpcS{1CvڧkYb]+X5^şNm z]&ԍ셽ֺWݵVٱ?zmvPkTPu UPyj)dy*M T,P)k(k(Mn `)`))A ^?W^r+P@ *PRyJ)TRyJ)TRyJVj=:(UTRJ}RŒ31J-AǩғZ.gWz2{F*#ktmpHzõ3鏄3[>:<>65|^zF*X,>O>m#/.8h j(5tl4ʼZwܕG|'{p&Y#Օ"};uzVh;׻kֺ2]}2iP& ʢdQ,z}Y+zeE2"leCl 2aP& ʄAˀA0(z9˱~n =R'fy>Y,)ީ2gs}8]9hK7慗ym.Kɮ~ N mm9R-OgmJl#I-|YM6Y Zˆjdeikjښ Wy<10!6/͗\P5;EڋaFYw<+̡JQw9jojo:w.{u_Qq,W׾OXehǫף+\]Fu>^;rRwG]~[[Jtm6]g?·m*|j>箺{ b/ sNb͉5=\ ۹GUę2GWs91xIY"OW:Vv߾_ş:.\zs6ȿ@7zd˯So:~ ycl܇~ Itn[HzSjsթm.C I*m#W'dR_;.!et:ݚXz@{E/(OɗCz㥺R<͓Sҟp8"<#qThNO)樊cT_f/==3 ˓+kE(U2J\BFɒd,Y{p=nMјڛ1v^߅sy?V BsxXs<1*LUUSl2p g_խ7g[=܂pb;=[sK'bV*ׯqZ{UauaʝjlVUr6yXۃV+kamrQV׾!s¥uNեr#@%{TCՆ:r\]}gB ]7x\3p^}auK+U̺k1uunM9̫5iwگ9{uyZxrS9ީTw*;m+J%xQ9h#3f ϒ$2f RwT-x3$ ,bZR,bZf>Ӈa5}XL~&y|m>~_+=:a0z_qn'}\TIүJUI?*G%}ZڮݝvwNI[S}1#/V rbZj}s+mgl?vFF\BC(}7Ӄ]+^이t~Ohȣ%3k.YK5߈JR1V ;Vt`Uu *l֥V,( ‚`bX)fe|Y)1F1z̪BF!V]t1>,̲Ջz1c߈W1c]fXeX1ob{,_FqkeX^6\˰rV.eX R.úeX a2A=l50"tbYhOûkg]w-sq}an"7Ǜ(B EQ5ve%Mwkû%;M&boӷ46wPEZQ3q8Dk1F+=Y;>Z 3Fx6e} W׊ru[pߕ2X![C{U+{w(M Fuglv/Nnp=v݃]|>ZǦPO ߺs[O+ش߻{[M뿹{nW uGV+3_kF5{=,ՊkD5R)w>_~o5_>?=u -ֈk_\hF4W#HC_5{FtN#:(lz.-03x!-_?E.~vǝq'%;_bWjnܧ†a+6lņ5ذ†p}݉ walX k.l `ߝذ`U` VX*IwoKU`$Ib$Hb$Hb$Hb$ I I>Ƹ1 q:5""wSU^ %zze,.qe>21w86?a#lX%> [vzN^骗Gt" C ٰ[ύQ)p6+a<DVNv@ (ܾns셰 v ̮o_B#}5u"*(5Ji q GQbzX8W7vq|pP'b;V,n]YqBt8NR .+J Fj~ c[ܷXorg|r 0`^j^j^j^j^fiW= B͆90|xv*Wn ,+";awEP9_1u|^9v- V  p2`aVJk0dz98nf [X9orbb̲xYA+T9x@Dހ›>( |T ]A(O'JRO'T | PLС З:u*Tuu)m/6{fs}n_(\7R.x$lldc#JW9.66vkkkkk ZfL6cbϕV؃}WjP(H,! 1p !gNP YㅬBx!k| k| k| k| k|xXteOgOgOgOgO'%'J0h3ZČeF2kѵZqHìfVg3Wߋ7 1|X Kaiow'̻`~6^^B7s'@.qUd|N.rd.{xW SrkE\5&ƒ<  S`*<>Gk:b:b?-VlVlVl|Ma3=R+_ /6cI`mY]XȅStTL12:t!Q(? KK,֒5 XK|?+ſBe iy c7_@%9E"vZvZ^c7@#94;xN׿;~׷k| LO8a8}o,̆903aBX/P%x«,iia LG1xi0~O x f,xga6́0aBX/駉̘@Z. b%|I ,7xx 1~C6 !2+XȂnz@@A($ R(J HR(J HR(J K%dZcN 0 Vppppp7u:xSoM7ujn5q[Mܭ&Vwjn57ϛK>'_}O>'_o=o=o=Ot5%BC4~Ig_g_g_g_g_WWWWWC{hzM=4C{hzM=4C{hzM=4C{hzM=4C{hzM=4g\%sK$rD.%D"H\"K$rD.%D"H\"K$rD.%D"H\"K$r%%J%J%J%J%J%%%%%\"X(I;DINC4[C4C4Fu9ߎj]$ 'OIz[>_%D"C~g-\(RD9GЕDgϹ"BD8Q.ND8Q.ND8Q.NS(J:NS(J:NS(J:NWx a1/+z8s8s8yW1yW1yW1Q!:DQ(ECuQ!:DQ(3}tљ>:GgL3}tљ>:WujV8Q`O.yGyG%$d )$|xdd I"y>'kHFyo 0)D8E"IF$HD8E"iG!s'k2((ux%HdI2$G#I$HQ(|C~za~57jJ>$\k,mmx>?q,Ũ b.{=+x"Eq(   @\Rb{pȉ |'/ Q)k |22ϾA7Mzo5{puܡ'w|q!|rߞE'|''| 4 䠂r+|4Cn[>On[(y(y(y(y ՀwQM֠֠桖֠r}\#=r}\#=r}\#=r}\#=r}\Cu.墺\TrQ].Eu.墺\TrQ].Eu.7G΄suqtLݷ~ sp'ܣS(4c\3S ]-߄ڋ sc-v.usN8u0RAٍqnCy q_GQ|q_GQ|q_GQ|q_GQ|q_GQ|q_GQ|q_GQ|q_GuEMb1n1by9V'ɑz,r#+um%x]*iW֐K}IU[ bv>QjDګBjI-i%VZF+ie,?ڑ8~GԾ^BKiM [ӺCi=!ҥD}"{Boqn;q%'J&v^J(ݍE8ZSb<_.!=ּH>V?cS1 Rsj$B?ߓ$g0TL>ma.ƈvNgN02_0IPz6D!NlH Ȅ8}]1b:̄Y4<:Fza$(6D!At|/1%a; |0wt?6Tx 7$̀`d̃< Mz9·L횳J묅53QG޷$[u<ԞHݓGȯtlnSݞTvOQ:Mep>rzAxIL)0B*B*B*B*B*B*B*B*B*Z  Z(u!|cئg|v_ozfM$~.r<rTg NXZkc1Xzs{xpJ@-nm'^ .lCog)Ah ;z 7)}z}?<<(^KO33cziizPxw)9lql|& G W'ɟ}g'ɟ}g'ɟ}g'ɟ}g'ɟ}g'ɟ}g'ɟ}g'ɟ}g'ɟ}g'ɟ}g?xA'YYYYYC.'Lw&;2]ID[A$gzUׇls ѨL'`+%rɟ\r&'gə|r&'G*"*"O)"')"("'uu:i> 4xh]tv.E_}ѿ>G_}ѿ>G_Z^Ch ItCwMYI4r4r4eML+ӧ£2#Kgtpsu4,gq,}: E~$tť0&.$Dv bs*9[%. agAtΣʯ |Ϧ I{8J4*#p5\cEٛCdnY ~uUџvy3L2D"e"ԃd\y!=jzҁ& Iz68׎x郼8[n/G 2 Q&Kvj2/C0LG`2L##g#g#G#G#'###ߦ/a_t%,eXm`41|kgF8*N(Juh:plr )MlJ8(*(Jxz_D f=^ WA"t--------y-cI-̜UAmi w #l{ /VۆQEUiVR[QQc%5QOVݷH?2)ˑa?#)82xrsG_Z2qu⇢J#^8,#G+яG ŵr4[8M&s?5OdfF}ù٦ [L`eeFuvТ_8Mn@?FBb 7kV]`+bN+"1YeO_v rsٻ-\9OX)ztuk UׇYRgҏ1ȃ}ou>>56FP 5:)zr`B\R:+,]Eag5x+qqȉtѩH5pLԛ8Ԝ0 y_2#խV6w?Qt<@&0/\YE߃<# F; $?ϧ> d6& S`*5wj)B|B+̺,f]ǺHzgU- q*ŜI9s0W@.nuahO'.pvQf"k&Uu"C^Y*T6)-Kk]ҍzIeFrо>kδ:}laڸ(5}+UDVnSJVRrPxJ>8QZWO~j\vxm:9X&:GtFZi#+Y *V#\+[hlԧu UD-jJM fjylG-Zڃ>mw\}۸={G";Wx;Gɯz/5/VIm-*F1Ral5+1AJsp)Z%gHXcVba`fazsl8/oCt΃Hg*7۝5~w,2UnS8x^V |v|֏Ru|z"Ǔ,ޑ3~up^u߰#tϰՃaV+§u;gz@OC┬GpO>pRduȤ} FQٴKZS?aDY_>:"Ñ^|G5ԇ8rd>mFAޯzceŅ}`.9C8w"e6LL<]0OЮ=EV<я,I?mO}<ч,JhHU`WuMk?Ϯ e8ߵFguZ=녙X㿴fe6f[ڷ q^m<Ҿ[m_9WպHV|@« Rx*}=\ކWcc^X$dH7ի^* *r'PD(K;r(ןU#Sc]$_Z,Tn"/oɨظI 5F[Ư8U]$wԟR_o޽; ("s_( qgn;O!Mq(kyf]9+"e2zv#(vsJQc2n͢ɸ#qxjL0#Ƌ1ehxc3fq9<8b1?27?1j 3/2/27/6/5.0/7/7~j06~f^g4.677.5o6o6.3ǘ6m\i5ẆLY.sY`k.2_023&7dhFd9LST3]ȅf\)WqJ21r\ova/+e_HmRiUYj35L 3G|5ü^R{ZP}mj\S\q"5I7EDH"Rnn6HYTU}sO6߬4E̺HY99lEL?1,4۬.V)V7VZ}3e::Kdc ֵ֕rujMX3k5Gښg͗wX NkXe-׬rk|*~/?)Vnm6ȧMVi%./O*: z5`uG56z^t+zquwe+}ѫתRMz0zO>59:):I=>}B=G>fDD稙jV Z}C͋EsѕѕhSY-T ԢLS1 cvVc^c]˱ccԒXv,[;N-r jgzVo;c1gsss3^ruU9}g3I<83:gr>wv:gWpRGrFr-<^-iMvzȦ[;"-wkufE{vuϝ;309 UQ̺$ӮꨘP$(  bƜPdz92\S?ѡܮMo[g@if*fyTW5#8]>OXX0V&VV۩"2+ LE$S6.:~}P;mv^e'۩H-J?%lTw, =bO!/P;wv3T/.aUaj!`WYf7:IZڃZ^+gm]߃':RCv]o7U¬ 䮗cKӐZqȲ6J&{oc,Tmc[[αl{?RK -( z ~~o8lH$hCQtfodwoaw||D/펃Js ļFW-ߋ_IYGWZ/6<Z&GMj|XbnenSת}RZBwej9 Ukԯ4a_mSiڥvу i(T&cnrvw{ȴ4z~'^IDOSS~> m9?ѷy''Z-e~fVDm?.Oh^؋rًrJTb/ʩ^1pϹ4sY`5(d8=RAse9εAU)tsw*2.d\2.Kqyct%1:Sic4cteedH͒ZJFj e 0^31^blT G?;e)2s1Prݑ\UFsFbr"K"?YI:*R#EP6Jlr?0+˸//>O}<y)??R(wL0DYYw$??̐!y')2OR1O.п%rSJn?%d` `srno&oA+0R1D1BufF`a>a0#HG'̤(L9FxƤ/td mPW-:=UCM ,[qt wԿ߉wPn7e=TcA A A A A A A A !8r?A R&a4!ф .}})1\`|2 RR]&Jg|!񅲁/)ì0+(l~b~fY*2j*c֘uH7a 6l6bRfff'2)1BL`B #PSIWJa*lLR`Yr2ҔÈFh˄y)Dan!FI`+&#=^Goi \LR})}rR4':H܄ y 㕈 c(h*%K?Ks#nJnng*^^Feʹ]ݮvC>#` `9{"Jr}[R|Uߎ\5vb2W,;X пbRrb1{=__˫__DKI Z/rnye Zo3@HDZlҌh +CP0n t W0tskn~,,\A$s| L|.s3@EH3e \K\+-%-#o7[)A,Ab8(z{ wFD'ڇѾ@h?rFR HRG>NJ0%ìx*&ؑ؎;ŀ{05C7t))(!x(4#E0+̂ cDFX6,%PcD 4tP(5> @TKjf-GraQl; [#w6AȔx}?~3$b|j[uZS ~'._~+|Ƿ%݊=/Hw)mg3d9 fڷ1ƋvZ~oI{"g;{^Ye/F?ocB2Cc'b fϳ#c@. /9c™{&ꚇO%#<> ;8^L gGs>oulה;vᙘQ!jJgxlJS5r-<#wnEe‘+Qg6ĵ{z3?l9)Qjnq`܅+6-G^b<8O __{eaJΡ0FOhaz?z nDC5d&wp,5V8%a{˗O_-6~PDZRr{f;AܱTXCxR%s/EnźҀ_#[Tjub=ya@Cm3/G|R!~WnݍÔ_-مvY{X}uh}WB3v7g.~] v_s5_߫Z3B7c _oc/?7Z1t[=-YG7סNQv}>f2"rܽ7Q;do7H6vT}!qgkX6>C"<}N?K"GQ{Yql_{a Ubwymg#&oh?go⭕^-Ljtpp^_3c$iy[I6lƶ+KoPh;k}(yKa?C2asp2矬*=έ*=]a/8.>Vqbeg$+8cYyyLdeMVqbe+Vq2yb19fUUq\bU7`U7=+܆&ێUq3o Xb.3poc=w ;pᬇ`=w Yǝz8b&Iz8~z8G~z8qpOfٸY]j6jVqc5wٸ[b*[c&swJ2] 6(͉hRλ@(Z\Yͦ2@VCNu:qj85_˩tmff]f'=ۈ"[s90`h=лǹ8As0P505t9Q#g$ l]Aغu/ =8[8||HMϨ9A^md *ߘoIV @D5$"WS+"DMrYJy/ t> <貂e+ UvC uAjUTqsRkFmT] quJc7J5w#wqq+l㈁{vݺvn]{y-0/5O}ᑑtrdTd4<KM"OGRg#/RVdJd*eS=kP3^(kt/Zx%TWroo$o7Bo"B;Bb,-RHrP*Y孢4oұ~J[{Q oJ񊂶z[Fx۽oz;;HvQsԼG+*]9X|RuRSu*hCuC:Et 6X( kUfR(s`PeQs9]e+ +ꊨʺ2갯kP)]SD~-]"MFuQ=]en!6ҍ("j"n|Z64XvקN<|Er=js B^h}+ԷiCL}KߍWC=u0@@ {Q@=G~͔k3<zBz4e5~R?I=y,ce=cG $ē5FKej_ѯ4= e]τz,=jk??џS)ҟ` 6sd^}E?H/ Q \KԶT/Jk`VlpOP}_% 3,jgy/뗧`ը_ݯA5ZԯFN룆~X6¦GoV|X[ ;Ǭ1X b`-Z kA BZ(Y beւ4X 5cBYZ`ւ4X kZXհ&Nw  6`0( |0X A6aj 8 QFW0:xҩr)؄6aCuPN _h8Ō9`*#,?6WșcNH?G,"=`~@='Զ,2,X*K! q!*>>>>B"Lj1DI1E &JD$3QNT[h{aJ8hqƹfj )ONyzX8npN`b;99G>Sd[]'|H?<{'ˎ`ck:S3yG^ ׶_ہ֧׈04a0WB`gP: 5Ct51e.CIe =[mS5X=@-Xu'zID5`V.[M}>se[AUs-kz(SeYTW+YV"f-QQSfUjڄ4kCTUnY!ڣ,*Y-ҬQ^4#*n*rcn 0s2n7q+7u7\ϭD O 5nt3vO#LLmI}pC'|aG7W.!\pM"OWM"Skam, =M8I ᠙AK --4[f>5 lGg~+R;a`ͅYr rSv6_ӯs);S3,sY6f׳Q?=3aMY l깨e+ᗍ_ l)\X/Qf{9Z9,l&̲ޣPsͅSSf!lV~ NV8)l% amAMAoFbDo#z+FV$3Eo??'+FTW:JtՕ,Q]OTW݉{@0a ³ELw>Da.BR@ݗHPz!Fz vPB,vL\II׎գ!B3V&D8DwAG½OsdW0/ H{#N&„D24Y%l?{}}CFH_0aD%Y!(q|Q"<Vwk6!@C3EHcbx] t@oϿ_.MwE2i-BA^ %ƿ[ϻ 8 :9܏;0ahb?zۣOKOFx%R[;} 9.PW)D wTۋKC[;ݭ#(h(qtU~|?ux}YpjD|][p._p1].艸a?{_FvZȂa00 aBq,!CaC ZV%B&Ű,a9XB#sXE>\uCX"'؞If}*,vןgM޾ '-,`Er7#e3r~S2pqnYVqZ%PmuZC筝:kh^QB*ANtj8ඎ vZ'|gj9^jq:jn\||ź8l8jnyU>^k<-iupHJ\2ڰB|u) `DeBᓡŧ\u< {|>< }mU_ O)vn@m|퍉|2d 0v!>F976fuGkadۘ}vT y3Ay ,U|;` XoڙQV#<̏^A s[Rn5ӈ}c?lו$l4ye}3I~ 3Usۀ..`/p߇9ýõp׹uvUԝct)wSWkUtl ޠ?܄shۺ?E6}:dۮ?]xtACﮮvu jO. !!RwUH.ƅ nJ]xCwC(-EZQtBPgA7=n]n nWYt__iR n)V;1Z!ObpҔ tFה$n.,W}M°rS0j&BS9@h*fWJ9( ^RXny; -PN4 MaPyvk?!{`=?~žcOO53!_kb9䶶i؞ Mbi)B,0E{&^{ D7 n7ݲׅ#p.<Ңcӆ]nڲwf=۴g jImzG-qےGv% 5v>xR}=$X}a]'{0⨵,L@8Rmsu}}ꡦ>Z[L-E[a'StKH_n>W-uC}}Pk_U-a^Zz5|VQ\K-PVQC-vQ2cY}2B}J˜~PLoYԏY`Չ֏-+IXUd˭%ψ%--XѲ_ϴӯ`C_2n}~M<m˞6;bx:Z-E((}Qn LQ{y,q,!v(!J>]vbok*8ԤSⵈ0d7Cr pRHwH6뇖77 q[6wiZA Fa pN<@vNv#A6@ၚh0PGPj8>'HOP}x #Ubpd@Odݯ2r`^lu2]a^C@3\vADqE`0( G~$LGG+:=>aq6 S-5yKW "x۰ఀޢ3,;Dw 7neǰ+; spcѩ#c~}2MGav+[]$ 5

ۛաXh9!TahN 16*Py9;t<ٜ~s `\57\W+Cyɝ޶j^k gWm>;:&͖b,fwfT͡P7;Ћy tȞ9|%t5cRӛGaG}PDhܬiM1Yͳ <긘@<Ѽ`N6Yf2%}м2w`_|O)`*"Μi~} $փ`9q1Ó1'94o72#x2ñJ$#{r5œ0tAs*yC8 2=U`gz@!3 C[121^RoDR9\^Nu7 V p=l^k xO8V b'{:}"Iz.ZS2)5]?'FJ)5[s鳀'$֓Ni-MR~i"VТTal=dkފ Ny~n[N{VZ2=,[AzT[;%  DZ-m>zVjLIC4z^[DZmoI# iL[d zG`+zOZj]{(7ku횴ںܚmtu׈;;F'ǭd_kLsLg|0֘<L0;SIOf,tSbgn0xy"g,w %"ctX3JY6g!xꌒ N٧7;hrnc#?gw0fKÞ/it^GC~jq968k h3\NYfpθ\o;7網h|\1w>n-c96aR -S1˩{rFpϔ"g^V}O=JTyԗQc_B)c6z~AGBgϡV G-א>C/DLQT MW:@RF*HP!*Qߠ [Q?!%rrCPn)E]R>GcqzJC3Ϩ.W=6yG%]m&mooտW?٨c/{~ydR75ojޤ4Q|VSD@QiZSyK|UsNѩR5z J5'44j4|_35cT}]YVY5+5l\Mͦʭ殪?/i~S5U(Ez;:1e_~CwYџQG>ڬmVFMDg}^AXKEGu)z- z=z;do51Y1Q51{_!jƗP~#A#thblbG1vˣ {gUvsǹMq\˝Nr%J`5[ecNVW:Uj}##GF'(8y"~T?T~T?U#OjTPŐwSRuŒgAS/~'~H[o#+( J">%G%E%G%G%QQ5^SZTqT1J'o1UyA$l|G%ÈTfyl[Ėel%[͞Z@R^Ey 40h $ _A2OA>-d1  y!?SӔFT,ؾ"_K@9*z}zz}xEʨoSZ%j@_!tWߢ̔UQšRvJDgfʏvY_Qߡ:з. }x,4fH]~tX1#8oǟƪV~ C /DX~e$dW S ?BXNXAXay&aG ˳$,Z!\8z.z' ?EiUzJcff%av yOsͥ͟'l>E`s3/5Vas9as_z$)E\E|ZWS2z7bjbb7b1Fqc< ]P7 #cP7~!^99b[0 lӊ̗X,jS^9¤y\aQyJVֈEk<[畜K7%V/,Uk2RJ#Vo 6ųM.>+'ml cv l~hW(|`aG1+dzc<&~IO+dOgRYds(m?A#/1yL=~_^ʔ+>0?+Sm?Arn0g Di:;6,ƟM96*aLvgw0]y?Mwm}m;)K{엟~+̰}]:jb&ޥώQv^1fξ %Įrޢ{rz[[lطt˾{]XdvHQN%=S.F+Og?xJg;.s)(X.] Y{O)81](bƻ4M~R\q6b۟Ň2b\q''OȼDƨD\9'Dl,m.KjnݒGlہOBΈ[\Ýq /->Gpa_  ';8ő\#vdbێsp>sCBw"vl: nQm'wQn8jGr7zna6<퐈>1GGmb=)_}%kIu X2GχsovXcǤ1CJwk췟ҡ_ D|1$ !şX-m?FjD-}G>C|GFdD-g/$=+-sa1/-&ǼX"eѱjq;g~Xۖ9K>{-}n-Wz"5,,ReB'""i8sYMk2'`wgՑ}9\[ l7-eEJ}<rKʲlH-eG:i'~c'<¾laЎG3~?aO81EDe'>FlK`c`MGm\*<Ƕ=W O#W\+eG8W:_w\!ѕE ;dW.) i$N; LI!U:mP"P(vרpU+ Ul-ԹX.\wG1yca`v)j+Ebwl0H s{H+ȧ85F1/{\Ǎ= Eb'#\D"1{f' \ _ωڲ&KggTk͔'rkD-Xk$XOI\RURhaU+K!+/]JҸ#Mz5 ]K7]҂WZ7t<(67&m[']9#=Auu^:.9G֕uKL6zۙ}ODqLiLuf{̶;Y}J|^,c|?|ӝg,y>שO8M8.O:-<~|SO;$+~3Dى78yygvs/;'x98;sw;#~s𗝷~{ ~yo8 2/_qߖwL?Цm)1[\9mKlr-C}eZ[sn+Ͷ"e+%[Ubm.rrM'L w6QI]<^l3[Hn8"]ߠ?]+h1Fo ;=~qp8m<qX}(-q˸S{xϸg|dB&M)Δ$Sr)ͨ j4Ma]f)TX;e*62L5:֤7MI2yLو.Six>,Aӈi Λ$=gcp/A߂UI4A_"yЗI4 Ȅ^Af }dC_#Џlh:ɆNolh&Ɇ~dC$l ɆlI64C "$i Ɇ_ߠϢRDrArIr#9R<ɉ~Ji"ɉHNDLr$')/|}DIN$' cM'OPɉ~DMrvw'Hz; >'!;\q:N\I>MWgZnLWA)}^:YZ 2A6t`Q}xC$njQ \Q`hW)_s:q$OE`fCpmA"`pe€$€W`瀷8aYz*Ɂ39N`_'A 2T=E%3&̨eS"hrY%ÿ#sڟ~LM|D3Zg!9C#,t݃@?+t5adLC3B. H m= KYp0~(Sa/{%Uug2" "OE@P dPD$YB ˢa]D$JD$HFQuOUq$';gSWԫ[޺u9[|m\_5-uט*VVl]{_c^V7ט핇+DRs̞ʣcj*k5`նl̉坾|kTL\:\ye嘃gY'ڜ*kcN_bQ'8s+7{;R"̥zMc]DŽNJ"Hg@܇zśěF|󊷊xXxxѓ㡳vX,nOظPs&+>R;%v 4f4>Sc;3C9hid,8 W3L t|Q|I|Y|e|uaRu=rl|O&~rZci߂ +&-+D_NtK\藸9Q(O WI+$F1˦%bĄDʱɉibKg-=BsDzY9!pb^bAeyb(zd.J<)ܰ*5͉.s%&koGlґ٪׼d^Q)1.5%[VJ٘ 9#;79 YT>ܜVt%G$GHH&X$9rlrzrVlteɅ'K+$^N>\ 1Ink[(l 1:VBGbɸqY&fVTaeukH]!5P1;>iYjhjd,R;+5IbXީգ+'ZiVV^NmLYY9/G1}Kդ> :.9yeͪ 2veZKQ->ӱrs6sdF>L?эUmy]/S) ˌJo5x{Fd3OZhksJ2;"hja\UΌ> 1>YDZUˌؚyX8/ 8dfyfYpfffmkL5.suUj̋nl/Uph6\i2Qƒk$y u2-7LKZnn]"0:^sRttXU>)~%ؐtLT&''ML?W99hzAzqtuzWܗ+?}8}4]V9UyU*LJ\STUMN Tկr+K˜gQ5roUsos*mN:^}3r99Pu$]]uLZm~o8& qx /DrcƳ_e+hLd#k1eU/uZ/sN:uNw_tŒ2|T+{?|ar͋΃?=:|ZѬ**T6lҰIjZtD=*[զcCb''͞,r )t49mh~t G(P#CE j-PsPCEQvG} EG{A TM*:)?!(qԣqMr.4H=zQ$ BOZj(РߒZ)D5vxͣ"=,i%n}ߤفLBxtLשw ԣ/?Eߤ.*v4*wwH #ӻ[ lv4\!h::tZgw U ?l]uiXilDQ4xL3;w{.%44Uh9衯gs|y:->_?q&Nq9u|m:S9|zn-/#eZszB[S e']#D%>,tTVHu7$kUH* I恌&_:!YO<$GHrJHlϿ)eu iWYm,$<4ŴToά'8-]CC2NGꔏ!!wSAg:kP꯱:91pzXg 0qs#^J$f71IU,Xoq7/N//j.-.\9R/-&֟[ՙͭb/k`xH3ߊ|#uK+iM^>Wzy:|||֡W?ȧ:_ynZ'G͉]g&GGF1DM?#R_D"w欰NDʱht#R wD4C^lz{! GyynYfHhdjMHNOɗ^ٝѳ{mu貳6KvoU?g02FMtJLLnOзlaZz6{ ѳ{m33םޣOfM_w}m-[mv'V nNǛWŋWߕhj!K5d/{CԚ=`I6z&7RXF<niaY#òFemk#vpČsxWa9Ce= V۲օ'gS̜S^q ˚~Ĵ=,^hfYc!,~kן}]Sl_T-}B: uJO{?~PP0QB1*B& M)<B=zRh*5B6 m%Wh:>*T+r:FBMZ} YP:B"BC<BBqBM%УB Z*ByuBma[hw?P~Z)]^XDŽz^wÿ́Zչֹwum>Z9b͆kVBBe=M; i}^T(U~]3( / ~==3' ׄ?>"r#֑n"}""7GJ0=*TEB"#"3ïG"" "'##"k"##[#Ց]Rnodph6-uJJ6-mYڦCdliK(-*)Q:4QeJ'N)^:GK>Qt| ЖmЎоGwg8受+ WHmY6WYVB *kYkKݠT6,$kBsr yŅŅ qq q!Дpkyu ~N`w]0?86xoPpR>_885x48;uC)'?nğ{վ|mwx$3>xt$qߧvNow1*NaO"OcF_:}\@-o{ $`wW+$FG{SNjJ8oY}R5"w NSMcQJu}}h.rUpTQB`>6?@GΫZkQ& y`H5JYk4+UߟskyZ~Kgȋ\լuo7Tn|ߑȱکV$A'N;=eS<2_xzzI:| 1ʹ'j$R$3h8AJ]D(u:yN$ӐF򂖢ZF iF"e!}J://+W+iʀd ux=iU x FOcm>cm>櫗$ 6ڦ|JӻR;A > 59X.Xn'6>טQ̣Ip2c}#RiUW}'TG"j34xRёl`M)bEN E=m-i=N҆H#iO )oD{LcZQ*Z/ Cg34xz{jlğs6mљ%iQX5H¯43*IyP{'>L_欢^U"Y?U2;~(V$;,{`= ~;K)'Aپ|39̂klKTU>R~@6]x w3.Fgc%}O[V&wK!J[?FOзwRjQ|3Ծy}:5sU֨O9 U"k&KP!2 .`om|I;]}/GZP̈/2#hw3/|>BҜv^CK?)##fG܏tzvjJ^(S0G$mr_,61MFʺZsXI%^\Gq/cd45K~FɜU1 +w zϢy1|!?vfў>% Zgң\7vzK)W-u?I%g:dW+\aZC_ΨN 2xKΝBgtGXX}w{\IKbHygfCe>7ǩ7ܟonoqG? ܦ KK;SM? :Rvb +v٤.Xqz\1bMp\HNtg5{{vWtZyiú<ٷtWid<`NKu@1}au 6ި'b;ӿNDr#YVN |V*O_9Ϲߋo)MI;l^[e,?4g N9+_#b&; c]ĒScfZ96kYwëj$bs,eMc y AN;A}yJ^|Oy_}DZAݿ nO#y,p#c=8ܹKiRsA 4x ix ި{ef|/8\~r2g8,Gth-r3mzjY;Ȼgafm6Z{rԳsOclI9wۥ~OpNuw2H-tBuN7fCK]hI1պ2z5>;YM$Kl̩#bP=Jюw*?B!&D

c ŨMt4߾ ~EgtZޞ >s֞:7!i yzo⍆xNSFAr-/RE"ZZCtڳXe0}<ӨXJr{~gjc78E;)v;_3|hY^>{kԓ?kJ8M8y\]ez8yrO(ڿUҝ- ڝzw߾*D/_U^958_ܜ۴A_=Ĺ&tL}): mQy`wr!D_f!8|EON=5`![@Z >!@K+8R {|l F nBCHriχH,$k\L#7mNӞGg?%"Z|GvKAazۃCǴ"IeX5W޺ 9hsx\չJ'x:+Mï v5}`*+'c,D_ez~lkʖӋrZ^N ib>//Sz˱\N]WSMb 'Č= ~/YٟM;/ŜfG?WkKg듽]g8ß)Nl)Oy7J}@ EjR$*6`tקBt>Puȏz"` QϨ=j͘G7<<7Hw٫tҽ:ֿ $E'2]Z=͹Df[l~yJյ^Fx>vٛħJ{>18H{ԷPu6deMYcb'{Zx\Pߢ_[AWJ UB>a-uo6V<䯪w`CFW&Cٓ*Pa.EnђȻj9ďSn'ɟoj{ԇx4S0y@+:"o;W/ '! -ĿdU?FJk֠,} @Yk;x+8Ch6d6x|[tt6+<?R b#l ƋAˬ­8r"guwl-Z95B`+:hoi}GG_*.;] 孴J%jQjbsZ4lA~݉YXO;ۋ~Vc~yh+huq'_WL}wV/XϋAm]9ϰ6vCu?QXN}-oP WE5𿒈z;Xp"x@/p)`CE #Ȣ{fsW#Q1/| [BG O{^$dR퐌ABOHC]_ S|'+7¿LsR%ft (fHy{x;8kHQ23^wBs39sbh[wstnOTbI{Zr88/Ϡ<@ql^Dkk/&L V;ijGAo@HI]zt!9Tݣ6sMc =hfCz|)kaB~1V!*nc >h⍜-JÏ5Ma ^JCbrl3_plLЩSn<Wb#ѩ4 'x_C|h-Ab¢/3 sֹ͕eX:ep$rQΏ':xj Wc s㑐?4mxf,:K@Dn2 hNɊѪk$lM mV'2.rCp# gw@YQlk:sO1,qD@EED$% "I$ d$"&DDDrN%眑xU}׿:k޽+k>}zb;_ω@XQXY r":8?_(k3-@ߊ|{B?!X~\U@zncaQUigV06YF@XA79BP +N>m2oLR4'j>nv < :45DY`V;ȹx rdP>5 l,4 y84џX߮ 6zUU(u>`>h:߆A!-n^:W!K5 y~'%!< %p-& 5;ԃM`24 JCMvfC &>.yO#g`fm}>=كTߖ.BF%ПihKl.EМ 0!XSeۡ6䑵>8=}(+@ ?0d?<Ș=F[9ry"'%߂QeI9䇐*d1vgp4*j@ny!=Qz rc`5I@@__a pp {(u ; 8 n=sۀsPÐ"O]`#hwrehŁauV ֣ab4ꆲ#eǩoQg-ߡV,Tk;&!쉙gWaƘwWPKazO>RUNm2;Hq`' ? 0S!@РŠU +#ROt:An :9[x3>~ݳjIA3Ք⛡8c >i]쉭nU)ePѳ]2t{bPOFƓ+mV R'vL5̭jZjv& Ȭ(Hg;Y5G29_4S1eKB59Mh>A(; e FYBSHfh? 2ϻ^7HrCHYƂf-6Xdl=' d܇! y&ZH33p vAn<([ߴ(}6zs'+AK@nM?7-Q[uFj1k}QhF`FQ obd\5GM4DgFS'Di`!l~1wx͈ C<@;~+)[Yg1ͦNWQ:\5u*.4bc}`).Fk/0Zy1ښd-8vL|!3;`ZJd>-͡b_-˨3oş/*3 , wi ++pʘT{];&lDS6#kf WWSOh$V(Wܱ[%h!m& hKi~E?SМ}7Sd4cYn׌\@0_Լo".bfB-S͓!k:[mi˴er:1=ňü3|a֠IuVX ꬁ^PBp6=6liFT3x-%zގGYy'É/Qvʞ;7,QAjU^Η"#8>F(P#x,ƕ[y' }W0#3 g=ќ?AZmЌ e|S=G7z?g'Ka^75koo3hϒojVe~0_B+џSo?nM+?fF@=!Ɠ*fW6:78i 7[Aw@r#,-/m~ ^+&Q `'Pco6 =MF#sM!{+VF~,⵩*pNa\G¯n/M1"#,>ߞ )&n~2l8"$gtub){̃$)#X2;Wϼj"Lpkh#;b^:S0ҎHSOA9ڼ!/:I4oH3򝟍5oH͝exoB;jev -߀o?CyOʼ'se0 #m4i\B}(˿Na6(tD:%R\N-ޠ^Mӷ&XbN~152Ge<#ߧBt/56ԁ $e2:գƺ:ԃRsjK)eɧ=z T^׈ӋԓޥI]i0e"Qv*TNsRӺu1%3Gu%3=Ou:ץ^ԏZR"un4eb('u'դ"Y(V⩠4WRE wQzzSjE3߃RnJt U65:/kn~a/ 򢚨/ڊb+f5h 6+j9o|haw[iwdw=[^]g{<UҜ7Lsf<w{`iλlMϾ|EӜ\|%Ҥ9!?cA䖶LWx$8^܅cX%8ֽ;"e=/7zL3 J9OHs94gҜtL eҜ7iӦWKs^#y{g\5J3ӌl?ʻr r r rro yHwzp#zGflAJ R8I?z$jV3jVW{NX-&GifJ6kQ~+գOӱtԛų+R !MD!l gc'4]dCv]-vFӠQc1<D<+yx B4iO]hʻbޓG@>V|$iwjVs[$*bd},݌[-Xi݊%m6ݙ]أvW++kourM@=xW摶rwd( ʥrt*#bU>OWTAR*"aQWE&URUJYTUF<ʪ"^WEVz\dST]=9TEUQ<*J"\j,r檹ȣZ"jZ|j'(To" (Ro"-w;a_ 5HWCQB%p5\REi5R j-QcQFUcţj/ʪj(&ɢT5U< 5S,5KGG#*FQTN}> =Ʃq_OP 5IM S)=>SSjFOjUT*/՗Z}Mշ[zNUsQU5_ͧjjZ@g<_M;S-;WRmZ{Zm۾6jo[Wm^%E{ٗU:fS;uxU1ڧQ:OEu2_1J-mfX#nZ~~ qUU~oﶾxX_as8{mc&cv[}=rQ٪G٨4fѷZBKʞün$b:$żc8&Ǽcט^8&ƱKLck̻EcRL 19f ]cc7Ǥp3q3\|#pL.1]czש}5v19fƮQy3̌ $`fl̸#F&L4`dJg#F0y#F 0UH=1T02o2Mȷ# >`䇀0 `槀3?, %`dIҀe#FV Y0&`dmȺSu_ u78L(/kqCg}Zk|.K? 4u N#?4F4>k~ 4&dT{h*M4f|AKC_\4~Ծ'ZH?"9rZA+i5ڏ6&LjRhmvi~:=a:BGtRt9:OF ]k;]tnmCQJf /+ xCވ7yޔ7y ޒyޖy;ޞw|2w|~~a~q~i~FY~N!@$.1)9%`$>5-=#P$g$W$w$O$o$_$d\d|dBdbdRdrȔgi}擸9TT}x^h@DcA4+:OGwhP|H1 E:uqI1O@!Xf%X;{)s%d;qky)7~t/Q e:W@cuXnO\4GK(JpWkѸ];Bz" WG.wh\ոݯq{֔TM*Qe65;{41l k\{R!%)IɂN1zJ+sLjʼ2 ^W%H//=?ckbɘA6-ek@&r>cf Dtd8YOH>b ?q?#hhOs_yFpqK_u8&c⸩em#vvM/Ke⼌^&/{Ћzټ^!/z^W+Ѷ_[ʽ;qWS**w1x_F:r{cIeFL>wU/E{bw!:de_eYAcY]ʃ{YcւVfmXJ`ovSYփJl,@l5xɼ';4{|0FC\{{|ǟ(<&8GE&Qf8-%E%Z ޶[SMtNogYk5}ݾMtl`}|r;13֙8Y3ۙs9+Y%glw.g{gMI}e/OEBlIh8[**Vʄʰաrrlֆ =օ**ʡlCj*6͡WB_CCٖkflkM ]flwE5-6촎gaWu΢.wp6r&$y?2/oFK#2̻Kè<9G~}Mӧ9`g}WS6EXm5Ř/eYY]s9\d1l YMMx;nsڹv;o څv].nKڥl+Kavdn}l?;C0;Žc8;NS4;c ⺸!n[ⶸ#",=c¯c'ʦ?fiQ2ϥןfN|\TA\DϒGG+^d֟8LIޢzσzurgX,ek4,1ZrZrnn<,%R^2Fw2xyO(Ɔ'2erC$b\b3#qhĤLO<\zw"L  >]"}bCl(ǘ)bf˟c b!- o8]A]nKk]a-DFl|1!0ҋ@z $^bԨ؏) S9AmP/ZS=ij45[`aEZüsYV&F)_W_4ҧuhc`Z&}8C[E,d6 EމE^!>F|& iDk:QML`%ֆ P!bѐ-fAvPܿK&|_|ff PԢ8"0au0 ߃]Gy vrm d%\5daVHS1 1k*F߷ypgl 3J  *V{tԹ#'Kp K~1\~QF['__G q- OJ!C CLC,ClCB8xHCI #D8$pHČcP8-ap@ x@af@ ~k A% .A܁vx^36%pY|kCm&.0r"0Cr?d0G2X F  , 3`$($#Q02 ͒%s?K*-.,>GKv GZa(=1${9Hq$h IKQg ЂH <f{;@> d`Ml` lar} ` Xg'g$1+*}壋5Q d¾ԑM}/>0C XbZpV|}`^ckXsz$Y0(`a49gPPmZBۑʑ*; ;   H=HHN(8PˁHr:-ƃ 犐犑JJ7#mA+CJ#,.,.,.,.,.,.,,,0(f LO4x;{51^(dPM}ӑDc/ē +WȀD( HH#|s, Ɓx/Nx0>/ٌJ!{>yD>( "(X[G#')4QOv8 $dB$$>]D7C}\{u 4n:7Vq5CZa-=n  %5'yDx$OyO3x<P)ό77gγYx#y<(-#EH $$? "IAjC 2GӦQ0k'υD(еWqnnL 㳫UyU0VӢ+f= 0XmŠ6r3.(wr;(w{=n/ǣYۇ'3usQ^@JLy+<雇dM YSQQQi47A!=Gc,4 `u]kl@5<<8 E yI""!#J ?%???e?e??d0geΞ|댥x f"з6p {>*\zMw^Q~nlWFֿA]|S:|~`A+&c;۔?iqkޟZ?7_~_&isdٞ9(ߞ~B? e9ˀOVA(v V@W&h? ջ7o|:ƒ"{t-s45`lO?0dF@?2V^8[&fˏp:Qn }8pI?/gñ>\߸.~ kl\'Kñ N?sLWcE\UqX`8ĵX \CXׅc=~VXǹx.ypϰG1cX|,/KY,;=`98SDsu"d-Ŭpu~5q 2spXE H G C'-"D`+]Sr &PQYg  ~A A q8@ A _GL &Db"1@L &Db"1@L &Db"1@L &Db"1@L &Db"1@L &Db"1@L &Db"1@L &Db"1@L &Db"1@L &Db"ߞi!_%^LُJQf k/qX!p-K Y:$gaT a&HfF GhEc`A4,h(J1%o0uwƥ)S ]i`\ Ea {I{7Cv{VpGrY_E#Z OOzx{q{R̜5CnYK/$yJ7_x^x|ն&ouIno5pahMDB:.151_>m8C=P )1e)jFnftux(Ia ӉrF. OHOzq^ؐ "r"J=ʛ́9C9|ۦ%_ 11w_/@QķC28LH%S_qTZEWɸͫ6t;Tva.!a 1r s|<]FgRi6M;z.^v̆5"ö2U;Ÿ3,_UU׊^h[;mnͱ3}x+&_Mid͹Z]y`}j6%=>sRr]uʹcsKڎgM#K|ﮚ}'%sX}!wJ+6'&%~K~Ǚ9Js 0vbHҎƤٛ釸­_a,o 5JˤzHGDX <ȸ?ћT@?yݱ&5͌7., iWvkMuN-)^%3kӪ󅁥l-D:x%={ViU/ox7hٞCIs;P &wbVЊcۺcOs7fߟ?e}Lŝ;2m.;=v\r[ٹn~{AluͳvhX^S[ѢmrX(n#d>v.H:i|r1״1U\uwQ2U5Y]YTWHlw7` DeC^BBH[Y$8E5WRz6PFP3CcJW`29P(؄ 2 kb$L~gJKM !Ba,HAO t ( з:SAr2ulbn2OW4ٜbj֖vDH[ӾL!kVOj`Jݛg:}hQlf\+jC!Q+{.z}ShO q={»XJ$g%'Z$Rf~r>cBzrW{(buiEJ~gVqdb;znץFiOx1V㲧{_ \ԲTjZ*. މ%UH)(;_/WGBHvHf@ (v @?=6BtWPc#hH2 f n }HV8V8D+XyA5-[yC*_2O_tJ(57ֽ > O%;cαfޟF&OXp7WgMB ph+eg.OZ+\Ӳn_~L*m xk$͕c΍޹í QOYUI$眼Q=^gr/9ݾO Ϝu;mE99i3럖?z-a.Ȫ785$y\w8h3!GG,=B}Qg:0MT]{!|T뎱<X;\)r~ip۲4 }~!XY˲qJػR#u#I,tV~dzn6vTML&~kRHPi˶#n>HNV|[E}n1\&MгLE {7O]BIYAbm=n{Xwfz77 T<Y8^GC"ܿ(h|^S5'52^7A<6Ubn^qo_wBF&lSXW'΋ʿ=Q?!#z'XBQT9cxȼ1= l-w݂|sp& 5Q)-'`Y@Q!寛?IB(e(+[gp#7/"{3PJe߽cjԆʣ߷;9*Mrc/tg.n6j~cwoMJYa@3)i/FohD-Uu=u^+➖1JT/w6:ͻ 42nP[]%MHm󧕅 Oמ#IF9>?E+kW&{*r;nn;JR bKZ#n-r^G ]uCg PӴ7 Y3w7(^{hk1)yl] *6~\M-h9_~P2xsV(80|;. &tex<,ӽrtr]{!c/]*<sծ!./'*u6ooW#``=3#h-Dž]*B6J9RՒ>rp kϬjQ!^cIBݚRF[XvqJ@?éؼ LƯ+؉[Mh+;ԕs Í~+#z(, bRf_h5iHћܵޛ v߿^{N\smÓYnj:؊JYUg4;6Qgk_ v̍5T_}O)x\\XѰEKv^e,!QǮ%k ._2Ν1kڵTw>Ty72NSԹhpʦEJŘeꞚ] ]M;)H%9g_'1e7-_oRoZ*y0$oϔ?֝_ m-c{+o_HrsN_8<{M5A|׬ZVlVKkf]qpUʡCr}AݓlŌU>v?'!wH9ou$^]h{ҍ|g)qeA9 xn81"pu{cL'u&i=4k=Gkff CHWnIn`~`]szUn6Ǥ#dgihX ==͞ǝ/{XR`\|r ʩv6VɺoAʂ|)j3kI*l&'¦z#{)L8[p(89k?V Otk 3ˇ~lq$U) ~ SAi8oރҋm?ɳTH^gM x,@N0eKVGXR? IqaqI$f YDs;J֬U$za Ó]c|'yY;*+,?ķ Ժved2_\3a_W݋q N5}SPwyØL>_nΐi! [0jR_ꃚ EE񎚓ojXhlTVg%m4[o6J/34F]*L4![j1{M^hp/T+Sh5'׼9p=;^56 T<5cyUS%w:yjz,@a`Cn'cEi+tuXŘ3fewҚ̲͏n"X2do~z]xhN,~W+$_ퟴd|K]3 :b7Hl endstream endobj 232 0 obj [ 0[ 507] 3[ 226] 17[ 561] 62[ 423] 68[ 874 659] 75[ 676] 94[ 473] 100[ 495] 104[ 653] 258[ 494] 263[ 494] 271[ 537 418] 286[ 503] 302[ 554] 332[ 636] 346[ 537] 349[ 246] 364[ 480] 367[ 246] 373[ 813 537] 381[ 538] 386[ 538] 393[ 537] 396[ 355] 400[ 399] 410[ 347] 437[ 537] 442[ 537] 448[ 473] 460[ 397] 842[ 326] 856[ 267] 862[ 435] 867[ 435] 882[ 306] 1004[ 507 507 507 507 507] 1010[ 507] 1013[ 507] 1085[ 498] ] endobj 233 0 obj [ 306] endobj 234 0 obj <> stream xUM0W=&HҞ=H%D!uyJ)Dy3,mvuՉٷRm'U]z{@IQVE fxv`keU^S0ږxߚ=ۺa$Gs|VuWUwu6OƏ{cdLS\J{m¶y}2tD,3I[p|ҕ<S 甼ć];o,f^:O@މF^eS9vJ М@t& z"C (fV@+ \mi1N̏@P2p &@)FQ"IjdhmuRciƇPit)!I={"Ԝ9I^QК 8Ǔ'OsN ti5/6@(D5NO"2>0Q8Xer[@ lQZ ̣G^q9k S 7!R@eqFĤ> #ɚŪO_>_,oSw#%7C4Cn`iʠrXbRO;ݲ.g*8E˨Cxc=6ο endstream endobj 235 0 obj <> stream x||TU9d&S23I2 Id ^R@ !)HbC+d bA. H}PT~_N9)=3fqƘXT>j=Tv1ߊE[z&XXa'%0~eDypv)va }~8!chP[?n;z3u~_o3V1}8 c=*qYud>kʙOش;3mq)(?C|EyKVK/ lg,:[1sKWbAhߌsĶ-lI=^ѝ^_Zݍ̠JmԚS~2XV:GWyBb#NFَ?=ktFnHegJOg/)ct}&u:H[{\GXSXW 9~ԽiXIg+o{~wϦSՏj`:櫓Nek/ЗiG~,)]zTu߯w\S.=U]Vo>Y7v~Wߜ.}1;SgLMRnӭXw  Vzvu*[?3dd|YV~2] :I./y_#\Ha`0 cL3uԙ:SgL3uԙ:SgL3uDR#HL AKυ?1tɺl";Ulg}}N_/՗yQڴ;XC&r0Vvulm?b IQj hӔڊV1?=>yyQQő\'sN.PG7AܭRWoCw9X,K@2Y|e6b6fSY%\6nI/~)_o;4_eQ|6oOgJ ďyqF`zϿc,P0! п_n9]33ӽ .f5(NU8)B!]"﯃6䃩:!_Vw|j WjM"B qkh/i.׶ϳ-eUbB<ʆ!osғ T!|UU)np4Z+vBmYYxn0*Z% \Çǥe>W=LV]"5:dԌ‘HM GzҪ(Ɛ<13B}ahWFŀguq#vq*"Q<ΑHʅMA7I<_MUgC7k))ԞvdT|ʅXeF),ǪGhGb_?Qtt|XAp:*sTe}4KKx454.(=H/ZVƳJ*c*376]v|** W kW5uAY.cͪ0OdDOe]i:͠9lFi㬾Y!]td h6f#n} 񬮚X[%ã/qPRCe 3^ dv&ؓkا0*TTE涶ʴ<0զՕlѨ7Buub,X)2FWaQeT(=DGz@hTg_Lh]U*[ܴrN6!6?gV5hkKqhWŃ,nVEA2X0z?k}՗c^jeD] &O +X CU ^]{Cf(C(# c%覴W`gz28dU͟ڛaFG#}%AxnAՌ+:9~ryvab =r'Zh=u+[pkV.GC\(R/:)ΓbkX-ŹRb+X.2)JDR,b8GyR̕l)Βb%L)fH EӥViRLF)RLZ*)*8SIR\2)J()K1NRb))J(HB)K1LR )H1XAR "_R}ȓ%E=!ERt]Ȓ"S )H"]4)|RxH"Ed)(hQ~Y_<Qo^Y.QOj׃((;Q7DYu&QمON](((CNJ$J'MőM"(Aev"cD*3Hd 'NÉ JFriۈZ*rG_(O~"1P!Pr}KtʾADD'߈&KW}A)ψQ٧Dc?}D!UHA8LI%;DoE&Uyu2F*+D/S^$ D=GY &C=I'M.fr N-W &BD=LV-D_{!.; Lt;uvr+-Tv3MDn7Pz눮k@eW]ItF˩ek$h%D:atED3AvAnl?h-jڝK*n+-#ZJh1u/$Zv׃SgPyDs&:hM4F6 jDӉjM%khdS&uݨL$Qz *'*#* aÄKLaׅqaWX2ht؅sED#Xv]®@a:pl hQhh8w~冄UD15#@ŽJPԏ9>Tw!vKԓ;eSg݉Qg]22.D~3L|ԋ(ڥ%yPB>O\DNXjv2ڈbDi&2F DQTSO5udT"Nm^V[= }8 ?a P-o@ߑ5e,_cf{>|>'!'ֳX{{g}ך}x-kM u۫yW_~ EYs[g{Eg3@mOOOXz,,>fY4;a؁([hB#އͫW{xz1 mo66[[oF_7MFnF?LW&x0n4tb5{p{/ e]-k5ܼƳf̚slYњ@liupU-+˃+,>g3C˶, ꖺ.YoYʋ^K–ڗ%E[٢- - -ڷHam϶Ep`"dap~psf ɟeVpf~CpƖ`}`]~mpZ~Mpꖚ-?)"R,/ m) N1[G 228"$X Y=ٗ'c$Ç<<<: yxX[7IfKLTm o$(n9%7?&^ wYq8-|WQqAq~%67ṉqȡaWl6nٔ m1E\b@L%6תKU Xa=fY&V^,0O0+sAaIܣW Ss Ո۹[>qXEf#+2NB(Em`&ίjJaE%`/޸ J) 7 Z't 6TeO]tqvL]$[E/la /~jy-FZ"K~OML|`XrkP..k5j\`X,K%b`!ggs,`&0h@P L5`2P T$ T@P L&qX` 0F%@1PÁa@(gC `  @ r@ ݀@ d]?> )@2D 7@, 0& 0 ampoZ0 Og'G{;[ p85%W s/g>ScG?oooo////{gg=Sn1` vہm@hB#CV` p?pp/pp7pp'p  \\\ \\  \\4KŬa:ϱ9?Xcsϱ9?Xcsϱ"{p{p{p{p{p{p{p{pcsϱ9>Xkcs}ϱyO<%Lʘ6Z9{Yl1[l#=>bمPfv/{%~#_H+EɢmZ1, YmOlLZ[6x"_KmZo >z 1(el2jX-;s\6A,\g"7 hXl-aK2,^ɉZ~)[l%[eٚufYUZ~'s>@Sr!]v .ܥ].s]zqv5õ:v=fv 4M6v;(5%Jgϳa{Te=Fqpb^aZ ߅oOW~A"q5/DMꅞe >>?f߲x!27k9N݊x"B MvMw^wOSr/}~?tGE0{H{r!lێ'(ɚ5oʾ-b[vn̐'4GZuf3YE-=^2{`!v}7Bk {Sa16?zJշql<8u;EE'*W#>l:ź3)_F1^`؈cnA'-|r v`g|fuܼw/Hshp(+ʟS闕?/P_Lz0T듪.iZNhR &Sl.k^IN1$^>9cHjRFC-NHqǥ)q#}1G us\F REdTtQQͩ dsufg4:,]w'>neo;[wi]K-v>m!R IBeժ]-5Еg3şlIHOf9;{ igsퟗc٥\Y1lhw7KwA7bո#cMQx~ɭ5Z>T9ۚefF9R2,,y@JAw3X8Lb$MR$6I1I$V,cJ=V $' M34Am &P"A<=+{*YYj---mlo&4sCws&->'ݥ;1S;E˒L771ӛg'Ѽdܺ6Hks,& Go{ٕ+T)iS5S5S5S5wVY);,~9]Q\NˉeOKJ9 rÐ,(IeevlV=D[ := ֤xFbnrqqqq-5yvs_ϭ{}y --{㻵;8qyx<,zhGrdGe2m k.X{5LHHj>cx0]z[,&>bI#&MbZHsKRsB57w(oRoPn8QyYޮʼng{?myxZ|.ob|Өfw˝2+#8<l_. |7'y3$ӥ3Գg> 6qA>vPGT2SO[.Q 'wRr"S"Ꮛs"^j|^fY[ku'Y$eپaɊބo1',%˛Rqqz|.|^4R \3x~߾Znmyo}m%qTw껫>VwKݭZW۲|6#6eCBC &a `|ɐ ηΰ̬X+/d/jWUZ<$~{?^)=1p496Kwn~c% N3``2q5q5%G#%#SL <20WL +Y̚vre"bC_Ѓ3޳k1F>w4؟=S`]⽣))_ E"Nt*''UQ!BDƻ67:4( lBלkȠ$8B>\L**O M_W6Nd}HldwlW_GR}"ڊnۓ~&Ϙå&%&E8&U~^qEg /C24<1פ8 1g6+b݂=b !E]fZQ.DFay~>bIvj=T ?Ne`׆/o+K=Olbポ ~CneDLJ׼fw箱>Ѷ됛kdUF˱ꟛa}$޻@tνNNNuPuNuB"#h$#`&ʄ2Z^8_p=K6u?h @Ph;"hx_j4Z4CΚ&چc.&:~%!K$&DuE').*gqhu/'ZmLWC͓ݡ̊"ۺU6&)դ{&[s=̢km/`{n#=M˳MZ߶&ipxMn2∽&vw2%?@8o 3@b]< 0Bu;Ep~.%*a<.9B!>WݧߩV%_c2IA`?fvI9|>b8 |ul%>Kr!f6ABYpˍpȖ=1/"Jbh^L~{o:|ӷHIYs7^sG`uɺwNPj. OpB Ljl(CuTgG)YI0{FrHػX(F$)̐DDXG48|eVKZ*S"c,P7htݔ.oHG)=Dj3b TS<]qH1|ϱu:҆2Ss ݠa,J8QG(`x}pl@z d5]P$f6Er RpQ\8a8=D.;>]*P2$ "dT氧oVQ(N"70ݞ W>Kٜ^%EcǠV5>gN %u M/ Z+\ +<+ٲ|R`Q0jӎ58PSs}X7zW&ԥ6Z8؄nTY q@<- ]ޮtQrZ<T?ǁ<ЇF `!E-SR0_9.G^!"rTgr (ҎD<7Nޥɂ`P%Q16ʼOEJ ո^}Ɠ7Ȃê$R'819NaQ4S?s!W7RQѶb`mJ1dźF-WYI%dVF`__TitYp`M>၁{'bOZrk_9ݱɁ;܉>>߇ V4+r7 Ӈ{nʔNhvkzzh$9U#I ߑ3vKmaZy)Lj]ZZ7 M!i}xqnn )NF!TR*EDRG2mxmz;;\iQgn9r_l+)&~w:Gm>|r΀]o^ɉkDPir$mƸ<\GDq-":[]W(Cc)LKe2XiY2Xi(ߧ)D]?؇OG)8UDyՊIwEH:4ka3-O^6XdJX{XDuۅ,@GF׌?Nvr:ۋeg1XIIlDxRMydAZ\hI;aYlO JQgAr,|,ccx u/N&/etMȐzRFo'$av**,>͋ɨcO߁qa`ZjIǯoi;=؜|HIQMkR;:AqMLrÅ;z{}{·R#;>!fn|a3VPTӱy)7@0܊.ɻWieJV>*}B8XLiq]0D!Rά_906S Z3H͈VHjR\b~%*~)W])0b0}QSZ1P-]xh.0ʇ_Ն DEc)`y`ەx^ɻ *KV&̏ɺO}KrSA\ȦL3c@tD4UR/A*YM}c1Z-2'ǢXwJz ;}kX+]`4* dZZə!B;cP.D +yQ3KF๙`,ȊȳIkcư:e=8JFiۙaFo!`4k,,%ZyikvMb. :jz9mtI=IV1z*Ex2:K_;A,#6/ cxL;~gB#"Ve>t#sцz*˲9#]t$e].6 9pck#8aAaC=K5vfwm_6]KߘxPJѯKf;eB{r ?Q!YHKe3FMHzkryd HSVhЉDzJ~Dc2L޾ihT^wrko53ao(᎑xq<_*혬Ov\04;_ܮ:quCH/iejLy)RM׵vXYc}s$<5z˪J/q._`lNoƖ"t$1KgIlEűOL1j[dP!H`ͲyX"1sjupO#ec,TjRSXX0DQ-ԣX Ĩƞ8#鄉-;_\t_'atcOh{#`{k4Τ 'z RV9^93weؤsA\ )Cj0S{' 6qp">$d)s&pW X QbLu- @@(בQ}Km^+}m3ݧ2=(c'p:C[!L Ih ,Ҽ*pAjȤ`)<1Sx|6[#Hse$ =v(V*6ڣ/[R6Zk~tUBFt1 +փ A[̣xjh/kV<FsdZ`pZI T0>LiNdݙwRP$Li 8]AAQ:X>*;JϢ}:X"X RM>tZpآڹҳ0omYA/|,5'X{2:HIKVLE{nXD@.X(HwX( K͵qȉޱn(}kڶd+J>.9Ј"VP*2V3‰ P` ZF٨n-Qa|ՉIDA>N*TJ8[)Rp!U*Ҝi}Ju:(Zҋ  Mdžo~j*Y.鋚 inӢXGo ^/V}HfEF.DEOiIm&fOIe5!hU r~ Uyזɗ\V?[oUPO4d\Qaq!_qtEh%n)Ū@~0]+-1aB{9! ,e Ñ\Htik2X5Z8:`}M1 Զ Bl8'`R<)ER^lݒT&0ߦKܺ@pLV2N vY9 >}I*KGW 딜/Vj_,ӑ ~[ƬdT }Mu,Wa 7&m !d<0D3N8SIXkDimJ}:<3L2o++ -Q/X RjWG:r~Cu._i+b3=XV t5јXE,hm k#)}䴸Jv ^zaT`T81eSmӵdqjQKIiLkt[ln^1HX-=Pq5{!C#g+({3;v5y<zxXqVr uVG ؉"tAVyh2ģA7Baƣ(b @{E? OE F?CF[>5ɢ¦2x+BKxlЯqjFoRg ?{$!47&=xH(")4M1'ӥhVmIEhSRmlKZ@ ԫ QEaI%լS%*)Rq$wK\@c؎ )x3jc8"~E<(FQB-&Q0 $ 5c·߁3pA 0l,rc~6u[V:ڜ:HًGm#} T,Nc$%V"KZQU7K@^uʜ҇xkZg$s=(~Thlk$_ UF^|D*iwòfT`fUBJWH?4ˏH+cWрN $5XAda-Y 65Q^4>`U4`PûJ&i+=Z &Vsy.ժJh7ߠ5@;#>T"S˴a#*}\7iհhG@1ZGM:R)4vPG 0>!b…Bq) ;z2BN-Nh;P1,w+!)-(d}\g$άfޤh8}<8J.*!#ՄxE,3Zh`JiͦM<:PA'D3B]D)Ns 84<0D_8T2NO¾ʖ 1lo(z#tg=$,ǔ\<[VGBo}z>r.RG!lВ#P#j?mDr.ߕrN"hklv3X9k2z׊zsW,\Drf?9onMج65eR< x iA ?r=-gCKb6"N2a(ׇ헪H%5hX^cdyk\ARrļ8!srJ=5j~Z'\+'#et"!\^j,+&Ss)6Fgrxwi!#dͥXR4et)0( G}0aK?2?Gѳjo1iW+5K_}0__ |:eFgtK;v|iWspLΎ?j%>5JN)y'a xdKt-~|u^캝I׳Sj}T(l$~KU%pm)?ߠ}H;qYԓ Q Vl<"i2Ur4UnLQ^k0Vs~aU''ñ׌~'ٝF F]sՅ݇74Mz,`~۵y]87EMN׎;Nd#}[n&_~"]u*d :G]czTARJDWBƸݕl;nKnٺ%+., g .lrtJ.E]D" Qqښ-hO#nD-(ш }!H;5-sLd ϘL!)fS-X&_b&f3qJҋS좼~挩# uz&Qi",7Q5 .-+<[t7{`lhWqs6LzSy?` lnټ;ܝvYOV~t"i )y<+#Mq  ԗD#bټ~tsL11$FiCݻfQ7 6/ϒX{_= <}trEF}Ql8T Uߴ|]/ DWCnlgua)TnZTYHOdJA*]|nT2S϶|۶A7l;su޿8yeDێ]=M޻N~:>Uk #k}UMڞz7wRÝ~oG`ݖ=wƲ8A| 8%d&a$*8B YH3,nDŽ7&OJdyi|bRFf;d^=& 1g&n⢨P'\G +a7oy0ccEK6&M;ny|g~ӷǧDh=VO玁k_ƟOm>xoݸɱ??x]|=HB! Q](D!D E썐=zDD\e@rn7.3qEv ᣨWGUmzGyěSx:"M!VB8;-֭kZ{*%eϑMʙJ+XS/-f#P VPtJ)ji-fvL?')sN^E 5x;UZ[h|Royz|`L0^Bo7]3|qӰ W^z᪚.l\ O_;qwŢ5z35wgIԽfٟY~SM3mt\n_*]yӗ**3--<-r[1̖߃+G%[~vv_hg{ ^+R&]I^Jrf~KȞ%| k,$1xjqjqB?˫/nUǛx>}OӔ,^l)硐髧WOKs}rpV~Vs=V/: d9 .?EҲ;B_R#z~o W_U=kʆ5_|[]T4|kAQjveuuٟje%*&zks_k_S]#G7D<,bUH.T~hm9dwV%XVMG1Cw qTΑ$W2r̿R0ǔ?. !Mf#Cq9mɑe6!sڬ1s6# M,D*325#yv)me/rc3%SIEy9ጌeI]\u9GN:- /{qwʃeygG~n፞dJdJdJdJdJdJdJdJdJdJdJvENSo0 +V37>€lӏ1~`~ =0?,FVg.`*iQIJZTҢE%-*iQIJZTҢE%-*i)d-JПFׁ1 `> yh:=)1,o_6`*h,# 0+BZ ^UQ`k,%oc{׬bhyأ@gAu`f4 lma,^x<\O=utp}8L328|- a h /QGبG d,y X {@8G_d SV~>F c` `aQ}y8󋈫*"P9_êo2O GHmZ~j k@aa.^G8@g B ~ L_{}lGe/Ulp4Gz;0ѷUMP]]GUB`^艈!ou(Gǰ/zNLhy|4<>Ghy|4fUz l&،>dSB,mN X=ut0 7=t~T l'ldy~0d ؑcuFr܀5W` ^>”pՀ]"_9X#.P%J1{(a@K#fx8 oo FY~#=93yAc6 X L XL??,_`e@v!?EK aRG)nm~pTpL8nҿܬeFv:0 0ڰ*aphbX*{~#lEE_ŪT%R}ЧןvbQZ$Lb]QZ"D(g`w7?C2@ ؏~UPZ ?T݈,,}~E(,1X. &aO "(c1X^ܤR`6JXXFX'}"'BX Az!#7zՈ׿"셏`- aצg”#0<"z;_e=X#Z.fXO\=u{c@pЙQ9.! RhB(F)4JQ *w:¤p{`Ä#T_(ww a/a3 ?9KiR;>pLl1aB֟Kǁwz}!`,0 L<0G(cz7FG,&!!!!!!!!!!>h>h?,>cӀMt qEcgqإ!/B$D9T W0!pa8鍓8鍓8鍓8鍓8Q]4FuѨ.EhTQh=pX?~C>G}O>}g`````V ܣ@чy c_*blJWK 3{ub)y G)8)sRXXC@ 65 }t^h&NOä}Q*aah'ah@@Э?,џ{#"0 p Q;BJG1R09 @aR>Be(?JX Gi>&, Δ`c.>3XGlc.z&!cXhM1FƱSbQ={vy#YyxFGqja.JX?,#bӀ6`4c 0=z\Uz}^\)Q*1\K.F[eq'YY ,_=@aC#ـ{cv%0Vc  ?T^` `~/Чث&_ȍد5z} fU"U`a \ޚao_F3lKT}ܣ?LaQ(aU*yYd~ " #L꿖qǤEłEX'"4vJ&LV,8 On1ۂ]z^q!يsAR??c@-sf  ;PێR D8f| j8Fk,1h7uI:(RZk+Έ5qFDL@F`hv:8ҎyBXشgI1Xg,1Lk1Nm.4u 7VcT+eТ:ۭ3kqb?xLAv-YF ;|3B!o^k#Ya6OsVaPWf#~m7#S `OyrmfL{Lgz 5v[w֣G3+'NFWGc;i$u,l'œ}1;a̰gcbgMj|[h ݍ1(ŝ1Z5h í46l#ֽi1'@dcb;jLQ}q0CvUVaz1W S-ڍ,(Sf4MfUfegOgEk1yB~Ts+1bdu"Yv i*'ϋſXMKf3DQv٘XLֈ02Uu߫-\LT9liuF,Q˃bQhK%Pq? j;--jhj`h=kӢPwۢZ'Z1#5wF:Z" Ҙ#-Q-it4Giv?,hQCX0);-htna6f:km0\ 1-ء:`h`tuj[hbCQ;k[*4seQ߱Ckcݱ6oٮEXK$ec]̸ gtubA]bI~m?n47#0%Rqy˶x@UZ&h*V7XhiG+dwo͝XxG%Z>\ZHgg- W-^} t_v,nvvĢfWQnCߖ8(١ţ-PDDڃXK@ۺ̺xhP;-ܖ3;C@0A* C3zt*ldyl}#yRpElK4 6.$=W5Pp@P?W)lb\p, X8]ѧ%>eAd/h'ZZp 4ܝynbz1Mvp7]g_ir_8,.g5?i<_~/(>i[u2IO/ O! +R̖txwWUl7aUZvug~۬,_zx-xr7%^ʿjB<_M.^34JKxR{:OyJK]|Dg>*ǤIm2~ycy3y\/(o^7f]9$AȪ .y%\.Z~K^+7o[wNy\)+wߐ?? xt"')p8z=NF.t!8]N׃-4N-.p p}pp:N NdK2pnN{wCqp,8} ?2C3"|p ^ N?Nm4N^p 8=N_9U pzUp NowӯO8} Nu=|pZN78NNp*i8:ZAiINb\ZN5 __Ӈ=pzy.W yB O ^NoVp>N>N N_Y~R(g-o9GR-hy".)t%8i 8t/8)8}N?b븕x)8WkpNw #Yp 8HJn^}" Uut 8[鿂{>pz> N N<%ƇeQBpipN:pN+npp 898}>N_%޲ۖ:pN38~`"s8 Nkzpz8 ӝt~ > NB{ ] \W+i wӻӣGrIi./@)vBp N08} N^'y.$x#+i8}y88!8=N/Wr[,vl)Ceo[Ȼ,/YQpC~pO#t\~nCeDN N7pypUpp(8}g5\ex 8ӵop!JE,&%!JApӯ{#yp8=ɃS^Knt'88888} 'H|2ZVR,˗Y-ʛ,qyfp ?O-Sw~p8}>N/Y]-k|z'cֈV=8>8}> N_Gvڝ}}9rڭܮI&EOmnߍ-'PIPWw׮ - nь#EzCd_f5{8x8eСAt念a{9KWi>Z$VDd?MnkJ&;d2iDTcP__mmymw2s[{wDKh 6+)~RXNmnŪt. O$Rld)6v3s1 9d.k,CX`"!JN`f6ǃ \vaLŦcm#,X-HU(X c+i6sb2ՠɦ2ڟOld\ц_=ڬGPH2|a(g,!!.;ZTl䄨$89 . W H Voienw5'rۘv!A8) DB&C r#DJq4on>_8<lY%o1*R pE#<݊DŒ{L*;ÉCWV]YۇvC GEohU%6#iД "' d&-٨V-\ETarfZS5e!'l_l[6m6sD*"[픠%وhCۈmUĶpUv n6ܨdZmTF%ܨd[_&EK& =LK:Uf9*s&UPq.\^VVw|> ;0"=[;NbqbI]OmGHn#w9mUW]){{ BT;W{60pM7Rf XSscizZXfTG"Uar2mWfHT1j&ڙj9aIBLnbn?iAE5CEG㾩?LM%6b㊸m9HtXÚI ^T {X"1oKl~@pXC~>%+%]CsQ"Q[)a~1+f H~Mb#RIM5bPgֻ0!wF3}~GNW iwGPmC.9WbdJKÛ@P@ s eIo1d2i2ɶvd9m˄4-#\aVdV-'htFM ĔI;+kkqpwifD;nVofx2S׮?an΂byl}LUV*s d.DXQXf"Sĉ$rBP] c*Z>*D: $up9Vi)KQdywc*'NK5χnnC<ߢ&"ơrsy*sfML Fp4{w-S}[쐸!g;L#>|<ٙXCn-}F4_&ͨD`@"lq I1Y&HN sII ڮ ;ʝosʝ7fRrrؿ&+eߦ%nD% 643̤b"K&/&;|;srIt*TӹBֲJ Xv'9Zmv-VCTN&gUwb95^yj&ay3zM{eNs:ẃxʛ;X;84cPKW^)gH]}7'']:Aț͚^e$5e[S}"͝Mkde_Oh5XǝTPPyrmrdg'$ OAn0lŚ'dըb*7Lv,N׍\GbJ_œ9} W1N7C%,qAh}XnCł^#| / u]]7~OxV G%*YW$AZ˺2 ٳio)ћ.Y dݑ ]9ܕ JhsJ&<ngٞL B\pU=^qci+iVC%UYul9~ w$KNeh%W`Bz/X$^=`&H ]d\$S! Y sȐ^S1JR:ERt)"G2rd-+GAȒdPݍJ_tT C7[G$ĊANW[[Gvv#UJ.F\V_k@֞K\|f,I,I4vH8Y\v.]###N+>xwwo?([NKbfxP?Muue#bᅪ|rsnNpn>atn֖ -;\=1ޓ>"C?D\ R fuַEuom7DAWG,[~e(azZyn^uwwou'.F?%P8 `ɣxO(xҐܽ3拋7/yKZm[7#VR@HX1\TljwrR*)ۧyס\ضcroL(_Rb%+cX~S_MݦwOC%vԿK%,ťSzl.SzLk.e%ǼC(z 5<^{fi3ooʀ}P~{J Hvǔc(g z%^Wf =jسWq#v'#ُ2bQGG;]f9;1ˇϲZsvuu̻c{j'a:OtlkcgMΛ8eRI'mrodLg&k\)dM9vBʦtgeJ?49ף<]KoeST M52S k32f߼nu;2mTcډi5eܾg_/{m{w7{geV /\œ "!/hUYiѻ>\{ё ?x%bIʒ Kf.dIaKg.}eY\ְܱ|+2dޘ\JWb+W6jjĪV^uU~ǯsW]m?UƱfܚk_gٵ޳vZmuvdeË {G]K7mo-vu<-ʅ}G֞EYK_P}htx~dL-3_7'oiɛgrnkluΘJ7vV-S{U_l[zOГonyn%f9?:D.ƷΏ[To^3{7\O~7X>P6w<(}\IYUUY H-19A?ߢG~e>5s1)֋N9~=|k=:f\=,P{{l3:4;NV}΍*)]Ϗ@Tcy]ڧ#j:KO;;taLQ׫ϱі#9j#g wx|1/>2=W{7ž]}v;>TST{NXKTj2lTJth6MV=2uacw:feiA\Qb޳^{z1GEp9(?i[\ib?4\*)9bu9J}̹K>W\Wb:KюIGYY68LzzRw50fMWT1gG͙CՎ5G̎k$y֩YGf5>ω},\Q3u]z3܈sͣ[kުfSӏx0V.s+#(3WS34uŜ-4skԚk3ZME*-n^SbÌj:9׼ ^h<0%j}TM6ZUj B^g>ijzsRZ\-ޑgnym,,3EeH-kSkv+vZ̕9֜$~asDZA'zp6_ܫJSka_JjmJc3i/Nbma[]u׉!@,74nj#vvp͖-.&_7k P!8 }Z 呄'As5#1їjÎ`Jr@8Ʊ x bwN̄EVB<h| qޫj5 fX&& 1*jIsM锹f;6@ȶd۵dۃd-dLm"6NKVTkO'պjIڤ-(*ȳNf0Wl*Z_oժjGZQz~pE2w9]NsVr .Kֺ=VaTk05U===XsA.3}ƪ fZPwV;Tk:r@rmUS [$b[s~]skO؇}VD w=Y^R!#(<+b?p<8 G+ȇ(J)A)2( _0ː8C;o h(7oo, .RjW ~!O'OۏHCB?Bp U2j?48 Ppؿ)'q2&dH[y fp3^-}1, Ȅl{>? Ӽ?yx65o[|~GNŵ_p$纟 G3 833'+3ow?BNr}twNaH\"Zf|~ a,#}kzZUӪg5Fl} FN{تNQW1/rE{՘DFbNs5Q$SԬ35L:SԬ35L:SԬ3W\ٖ+Wz˕^r+\J/Wz˕J͕WWzÕp+=\JWzrXaDrǧ~sШRU0 n[Es$nIݒ%%Oڛnӣ2o#-}p A0!0Up5   c`,k: p#&Da 0^+*ބwކm{G |l-Oee|s/de/\j=Ճpd1;esf{ 8( KYZ'v:@GH厍UyұUv xgyِK2 MvvzAoYg_ ߝCʱQާ.,w '  B2\x])E.v] PwQwAw=NCIP,pQ7O.Λ\y2`#9,qP>]'ZXȂDHl'O&v#Vu,cAsM_Աpu,cAs֐m-:B*u*]Aw=ՊofYx1 uwzi{}ɱ^C3>W?頞f۹C% +g;vBF,n<9*ggff׎3g,3:(O8ehltB' ]R B7-<ˡ+7(dt vH_IwA"$Ƴ +8s-2t+Y,i̇R'6tbӉM'6tbӉM'6tbӉM'6tbӉM'6tbӉM'6tbӉM'6tbӉM'6=I' a*dͲu<.pQ5rؕط6ru64P+6bFۈ}{{{NRܑVArWʡ^9+zP#?[_#@5PRjRLMm}`řAXΠ3njvԮSbjWLqƏ3~g8?qƏ3~g8?qƏ3~g8?qƏ3~g8Gb(Fb(Fb(Fb(|Ë}Ï} RO'[?OC0TM"T)j^ë}x5Q#5Q#5Q#5|C jPÇ>5|C jPÇ>5|C jPÇ>5|C jPÇ>HGtHGtHGtHGt '@"~q %"vn)DBtHA>G7&_H_H_HԣzRBQH= G!(|A\a>n: {S}ur{5A<B6`7nF7}Mot7nE7~M_t/! yguiax6F7ޛGhaniaSw]:uשNuSw]:uשNuSw]:uשNuSw]:uשNu}?mTDb8^F8gq,rsݴ$"HKI"ځ8t(D Q2@ e(D Q2@ e(D Q2@ e(D Q2@ e(*"ƛx]g/̢|C 0d=td ~w{n/Żx****************iv<(Ӎ9jS $փՎq9H< $a]7u=y񤬱~&zRz5X eupY'du[[K[7[7[ptna6́p7~|a!,Ű2X+ V*O5rPD (hKQQxģ (GA< Qxģ (GA< Qxģ (GA< Qxģ (GA< < < < ZF h!-DhB4ZF h!-DhB4<qx 8A<.<.<.<.<.<.<.<.<.<.<.<.~ `.\۫ ? ? ? ? ? ? ? ? ? ? ? ?PPCA 5PPCA 5h ZC5Dh ZC5Dh ZC5Dh ZC5D~DkP"8Ep(CP"8Ep(CP"8Ep(bB^W^i6M5Wkhkhkhkhkhkh5bԈQ#F5bԈQ#F5bԈQ#F5bԈQ#Fͭra,@V}~a!7[Aj6}9sTLimZVFKkGKK=2F5|ף̮(mѹ -fMdw-]KvגݵdwRoSKՒ}d_-WKՒ}d_YzZ- ťomhWhlJp"}+ѷ6</0S̾d%Vk%Vk%Vk%k.k.k.k.k.k.k.k.k.k.k.k.ST59UMNUST59UMNU{%W{%W{%W{%W{%W{%W{%W{%W{%W{%W{%W{%WU`9LX d7mOq"/?Y/6hF9mW:Hg&Ϳ|he(VyB}w.Zg2ߺL;_x x/*h=EKՙ̄IلW-{@,O3%xSֈIqUK)EZըzUOj1T-B"4P5Q%QAEuTQKPPPQ/RQQKPQPQOG=QLG1tQJGjGzGzGzGzGR%(UR:J(Tn.W[?Tcnl|L9q{G뉁81oH v~Nt~NPmeUbզX)ę8!8q&%>x>.+Kϟ _sF%T|mvxˎա.CCx^2LNq9~_֨_6܎;<kcix@;ӝ0*(pS7zlRIOᷘεΕ&)

>s~WjaqMұ"%Ɗck*Wlx|\?}p}C^;3cgv IRssԯZXk]s nmTTTSDskkgq?Ǵ?o0 k5JR>C$dag_ng?cγkߖswڱ/ٱzOvbu4ώ͎yÎdg4//y*F"^=a$ϓsy*ϽaBzY*s=#n5k!Nu΋7kśFIysF?G,#1.rQ^˲i`؛[ͭ22 s ,S ְBT_!7fde" ~l4st|OrEN~:/g˙|kkZ·ZZ~_.23| ṉ-c-W(7s,^v ͛D&6jgE5,HIJo[|c (7 q -D_YO6"kZgDѼ "֋׳z^Eze׋z^HW/E(VX(V+EU"*jhU SAt*NST+: R'*ՊF(/5XD&*e]ֈ.kD5Eh$24 M"CRuVNTX#4Y:+Ug7Yz;ގz;ގk^ v{^ۛb]d7Mvyx3u\gb};j5͎z:OkZYuu]`Zuu5kM{=bly^>OӬd^x4޼\޼:Zǫ:}Y>x^޼{iُᥨ\G)ț:m:0{蓘>e2nrw[imtUkvt=]+i=nm춛CwvlXfk=bfL[vU{!;n^c+|UdD_C Z<ՖX[QD'%^;ſ) g׋F:+ξ;;4Ki+ͼ;Ks24 fgffif1z[¾;w%|e6l`۝zؠ V?]ɶ+vT+K,UlRvwF5> SK1SK1Z;)׵촅2~+xJGYבEBꦅinZjx@ɴP11h(Z(j%JC{Co{މs]vdq'w (afĆp߿Ӯ-pBJMJyuV{kêY~jͬR,lT34H3k4F3k4F3k4F3K4D3+4B3+4Bs4Ni88 Cp6>sI ?S4>a,p>p>."G^/-{u7ⲷ6w#xΗ`)5ٍ8(8gŕCM8qʝJ[UǗG}’~ѡ8'$S p!/"|_u\܇xј0#p=~a6o͛gټyvaI܊p; w܋p?#x4̶U K*A7ځ$BU01b1;u㙎g;~ |y>#>>#qZFQ|?GE?zG?pn V<uaoE[{l+:ۊζ {D:ѪNIJxxx 3㘍'$o1s1;<}X^~jԻ_Cq^PpmpaJ0Fl_H\m_H|qLSblOEo]*_ezZdCtbbw9n$D':\acnD܈Ix8/Fˢ+yBhj'o'5*yx1fTŖ(#L_&/*S TpR:4|4'J}a1A ~L?ƊcŏLj_J_J=,(cp. vx;mbzt;} &c Tv|4:n~fϿsvνvνvl;gvzkTN41;]7,<p 8ZiZiq, hJ|߈IayUYX$\$7&cd워}o2v܁;aq}S1 ALC_}2QafԻznD܈I`j1j88888D{U!jKd%gDq8Q}>y>OiOiOiOiOi*ll#dsdj;׆9ċQ+R|:!/˵rJ{BTV׷H(P(ʣ(< *ʣ(PWQWQWQWє8GSb Ɔpjjjj*bz6OI(\Wodꗚߗ_ Ǻȥ78rGQ9"" $^^>;ʨ buA.J.12ZFhK_+8A=~1ZMjXb 'Cd"N󷔾U0z2X='bDL2TꊘG e"V[jXm-b i44BM!NlX멦TTi4ZG-fQK㨥Z?ϫjZ?ϫjZ?ϫjZ?ϫjZ?S]9+Gu娮ՕrTWQ]9+Gu娮ՕrTWQ]9+Wy1}gCMm.UV -G(\d㞝U>UQԏU[!aAաQ&.U| ) 3G-3W7(Ke),ŗ_R|Y/Ke),ŗ_R|Y/Ke),ŗ_R|Y/Ke),ŗ_;4=|育oE_)v>[eWF\~^tIkçO%^/ k۴a߄Jlo&Z#-aWttt{kSaYzXO|Z?Ehˆ]rTe!z9G/cbݖx9<#ǭLHnO'!lߡעĒ03QgL*IJDCx>֊(+S 4?zrOOIJnO?ˣxzoz!ԗƲ@ iT T`!CqQ8` q1'KauE2b"n$L?O3܄sV݅q}SêS30 ^~Uig|+Ǿ'vuoN#tboľDWH%woJCݮpx{s2>Lt{w1 dud6 MָscɱG07b~a&~YxS-`.a>~3x.N>/%W*^X'rJ 4 |* S}q8ᣡ1q[?\%XXV mt`;v;;NBoqXX>p1q`2.3l.ѻûY^X-_6`ᦫᦫᦫpmjbTP?O5SfL)V3jX4]4]2]M2] 1] :MЖ>9ҧ/j] p.п1ӿ1ӿ1ӿ1ӿ1ӿ1ӿ1ӿ1ӿ1ӫmjӨmc=Njߚbz37۪Oi44lN 7bR\7[s(h)?ލet\Kīk %хl}bھO"sֺ.:^^W{}^ OyRAU,zKlx4>]9^ϗ?o ]9Me˅ek;#}7=E1'>li4 wP 1Wk宼OM4aFF59{+:!JFC F%A5A/=^ƻ#i!2JO&:\acnD܈IPP5P5P5P5P5PPP_PzZm/Y⯙@n11lq-ٚ{Mԧ.:>:e`$.ee+J1wYbdxDљ[)ɳӓCSY(o3=m-_ꩦwML|ۗ{[v*>[QQK(~d_N t5z*unER{9+[,*>a~~yyyyw>/I')RkCgo-21atC[oZ{~,Z -b;XY.v}ߠ俅k*#Nys7{XVf].\gCppj7r(5s]x,q? , 3J {*g_v!:O WD'b&0tkFלN6]1MA%[W>Ș7 K>GaEW4;9nŶhX$Q~*jWߔMyil JkܳzT?=yz/-g~M-U׬۪kNؽ]mw=ybVGvIb.o%Ɋ[]'Y:=ē}zW]ɔލ*r5fw*JySՒݞ*.ިnUj%:vu?|zVvq[1cծ~3FkwGeZiJV6NEenv77ᤢ4>ۍޕgGqtBe֎Zv%B4j뜍R)j1)fP=Ʊ:{kW'k|>1 ,>ѽWTYRAX)=[Z'auOenKw];G}wXI9fGw{Ǻ7 v 짇#=xkMuH=b[G~]k*.|DŞm1rw7$EG_OnQWn|ڐ<8A9޵>PUr6 ˓뀨۫8q rキͷ/{00#@q^1 ׎w'YXC8,0nYO}btWrVqF;b%TZϔrCoJQĮ["Α}g[E+EcD!ɊCwWQlٝ{3$@z(ECDPTl)*(M)* +RD:ҫ>̽ dvLg=3'mFŁjͼȑm@#LJ{iGT;RKy;V]R+R+ 28C*B&M:_8\a6^B-ԀKح, rΌLS]cHvR -tYgogqX3اmnbIQ}ؤgP5)]C5z75]ADz }} }M h->:MPVYIV+Y3Z͚ki knM5kM[٭vcN0F{3H6`X)^bgڼ.? E\~ 5!oƛj~ k¯7xKޒ][2~;]v)Ϯx'oޙa7sχ0wX'͞s6/|v6{ه|??fp#}& Df$¾i"(L(#ʲJ [,l8KŖ[!jl/58EcA\ .`E"I4fqm-D[K'ڳ#x*r)\!b(d1G} \<ߋ<]xYG^D^K*^#{x{|[G{=~k_d??K|_͗k|||7|X|T22)072]Bg#Tu,Ju)q|Z>+ZMD[|Q!N9Zɱrh/~9I'SǢ)?=r-IP.bX ENnCHqR*b:W5TcX,RKů /L]յZ^]/֨Xڪfu[lUbꢺq)3YOj^Fxj奩qjWDMRӽ 5׫~R ojWGRf2޵AŠwcP98û)838˻9n {A#֠qk\\\\ 4 n nmv.AS-=<:}ǂg~^{< zC^ o0)=L&{;^`w{>G|ހAz#:RɈdxc#"%qґk- 66;ۣ{F7zA}~oJއNNG..޴hhozOMofWޚoktYt'?!;P.a_:aP) 3 ?$_JbQeDwe;EwuW,ei=@ Ѳ~U*qMYOߗT=]^?џȦz)ԟd3Y^ѿțHҋrFz';쪏${u~kV; v]Am<-@Cn6fMlG7Xjyf"wgP׏Tٍg %r0fZ[@OY%ͧfŎG(GY@m-0=/g9#>#O]NmO[GլFO8w[$ԣ`O\Wf} GΠfdOG(GӏY|4WM<{ƛ/99穿fބN`ir u Z@WZCMict#kCM-OO{x{z"㫩;_So6g =omsoms<R 7Vh#no YH?OoN~"g7~Ft4tH]֦n֦U֦֦֦M֦֦#ekn j"֦cI֦c֦cX5Z6nkΰ|2(%A"5(ۃAQ. {Ai>(T`糇`u֗uu,b/XWkn % `=ÆdΦ7l^`~[bm l5jkk `ۭem v쐵#akGpIL*pbQMܗx5Ncb( N2h"FI'IB>FZuZVE %|ZWZvVΕuzei'r{yOFrYipFjh}C/R*—eʗT(wZkN_3r Jrب0tW!O"=Nsz\ z|3U͕m:]t Rb2o qoJ 6ov{{(Rahep_i %RH]D bu1y 4UMrjQ~R*%zKP݀>>ӒʨU+JR[j^TB1{> d: !qQ=Z:N(ǐn代1;izWH @52 UCђajR?)j'F"(5 cX3N$5 )oz m>#s{2]MGP/\f :(7Jj5j=ڠ6RYImƝܢRyMmCyj7Q{WEK(:(:D:ڏ#k_5E@@@@@@@@b@>}[L!b 1))]vd,$, H',LXDa¯ ;(٢ 2YMw;5z z^KE:W7 T\o[ߪB~z;dvꝈһ)S{ W}WChC5S-~!BJJT4Q*& aHŁkHI PE7*tDX,,a)J KQN,r/G؇t`R^ GQhAcq(s|:hH¢!%[4d ;q4]84%PM'Ӈ?"hS? @W`aEFu8p0`A͒Xk>Ž#g3%&P2Ef 9Lq8Ô0Yx£`_xTDh!ZPqҽfþRq [,p8XJ&Rl\G`!:tWڢ6QM{/PpKq0)݄C7-]5W͑bMk5UAbЭCCL[6u¶-Pw l!H8Ƒꈔta\U"oYHRH8颪\ϩbQ/p7H Bža_C=PSDFшQchW!oqP8́`x >V!žطqzquWԡ^C zکv"ž"eƱ0N8 ZE;GHcEQB)!3)OF)0(%q`MC/YҀ,{ߧS0ŔB%M%:Iq8IA"HjX4, iaKű Jؑ#aG!)WPpr B~P#š'^kyºtx4f֛ _7k`ߠi95{!\9KXRǶfFB)oU4#][5@˦fti>KX[';f8~Ɯ]g{rt C7.ߵ^uo0m)%yr[Bw6KDZY (+ْO♮fsS79O9r{hg'?緙;c3;f:jᬟ9ה6O,}JcR̦~pLs3NCV{P6wW }yBmĘ.qwU }>gOz[G˝bo~A]GyfI,$s=w|qwە~:;^Q4X1F)ǖqZJ9 \蔙x:ZR@q=y e5 gi3)ЎFU/;Ew 3qٷO޿{;o qՐcqv(f ftׂDzn'y'YƎ?%˚;^..=Zѭf<'o5ulLws6Gf"ܾ}[o;>VVٯjU󚙖X%!-\sAf'ޗj/Ͼwup8vm|b_0kq'_ceeb֝d֩PYl 3}/Na{vy׀uqI1:GR̜Ҏq;3fS_ŴKý[a`@&5NJ518ˇF7:|e%l݈1ie~JYI{v#v1cN>fm\oV\9T#?#{H׼g01Ljc{<; fo7RgHK+Hy(^qxֽ`ah&k6K?Zt4ϧ_w:/Mi!ż3|0-8Z_i5§& gNvOh_~EHDHCa9_rU.AuY%:rΫ\'*Z,M"Z"[9nLMfzzcwXOoN?/i~{cKƺZoƺ[oq=>{xcC76xc76xc76xc37l%b w7άw7Ynܷݸx G˱]レ5>]/&|_~wbQ53hZk||1߰}Oi>9om}k5Ƨ3F H]Q%UJF Hy8 1# 7[[-5ہM~uT^PwՔBH b,[[ )Ye3^UE8aqM`qsW/vB3X+r-˵. \nf}Y_4?e؋T jt]ӡvM5잍K%5`s7Ԑ} 4oМk#Lӓs_0,8L/L@D>JITOʗu(_֡|i?֗tX_a} `w'~I%k BEW"CdPU)2"; `$\hD# !o/uZ_澯}_}=SY\@%eIP ,+ˢr +CBE WUɓd5J(,y֐5PZMY2d-=[Mڎsd}H6 PBC٘|D^ K%R:JAPK[y'i'>5ʎaى.H|Tv"1ZUvo!G9=eOKB eoJO'P˓I<%B-`T20jArmye areʗ$p@é!GnR- (aM -d}KMw;(]NSw4HNCrW?S]0/>GΡ33Bk5R@[$?=?ɟ!3OC rU B'E \2\.GurJ[/7B~?n{p7ʽh>y2,cBU!RT*Si(U8S%Ti Sʪ ]PU!:JjBٸZ[v7:>j@jT#e} 0˙L3!gB΄ !8Bp&ʴY΄[΄8852Z:3h4A.0'9A !յ̉9<2`Q t(H>&A2IZH|7XHܲ@`[TB߬oҺnE-*[TNmUJBߦ@N}'vK{ߧSy}2!AwՇtG* f;HDUwEMw⺇~螺${ސ|B?gO?AQ =`dh0= 弤_F|zWPH=WGQTI֣eTuUxH' >QO$= Wo!|[C]\}OStHOCt=)w~? = 2TQs |@ʏg 6EY%z Y!\/`+Q**YL%{Qw qR*RssHp0]d4RӔf4q˧O#4˧]cǧ/q|;&YDǏ&쉎_8f|cE3.qc9OD$w{i:=͜9=͝L0搅gP2-S?L9w\v 開?־NH&X !B!RBBJRBhFBA1]:u]Ku\RC\?R겮Ǐ.e/yBv;{O;43tf>(l'v1^Pσ"F6fކ""gO*̏`)Uo  UxAp}[%_*p0Ą 0Ą ѿ &Ri{SI口"OٟZ1v~ Sa_èګQǠROD0j1SPW"P'"/a}ūQG4w 5kQ['Cm!)F07 :uPT=b.vq*P1ZZ &ʛ8Jބ* Ǜq؊bToJ> &%7s= Or1MKP%oF\̀J.C"bTɛQ%WJ~Us/_R#9-T>.E}ʭBʸ fPAj /<De\-T/~u[Poy>y`_F\B O(Yb*xLSaX,c ST114KLYb"*mLKTLSa ST")bKXLTLSaXe9e7x%6ǿNNa+y6:=8uϳ=+y*e~L=O)!!<󼁞E 6_^i]&ºu_&< vpA=aRwyLݭ6R1t,Oc遺UmRz~hPPџ<d; .)t)OZװ>'OK$oި?yIę<$_wSLI:F߂3yah_}3yɳL=W|N}B}NէOOҳL Г'iT_PN/B;u&Ϫ?PkROR /$ς'%mI::zޗB'WF 04W}S} ZhR`zQuyy(摦]4;0O &f09b6i: >٤)yM>n}<|o2)OY Ki`f fc`f f\ Ki`6&fb`zzy Ġ?ߺ~+8mྞ@,F]߀c׳w u\Ʌ`ra&`ra6&* vįZm @ 0Dp2qx!v(```?8`0 8fs_@O.C&` GH; q$@* #r k^d_QmJ希Wj#Nj쏜c{izp"X/H@ H#p}Ү#שݲv#zp#(`ot(ʠ >vz>g%r'gW[~mvw[JN $iO ̯lϊ.?Y"=>دR#ޏ"@'k @{:`W]#`rCۼv`Z!x{O"hO t==Y{rVVar-sU푞b䲵ʁtv:pM;S3p-Rnv a}xG jmz\FԙOɕFUƧ:ߩ3V\b>/k,ȎyDo$7_5,7iL+rKd9< |oTL^پs}r jӽwtȯee.o^;L+}gd]:xͷd^y3[Cͷe]D8']NwKVC;@}yULy} A mӌXT\ګieS')dOp'Փ=EL:`xJ55ᩐC}y;@%Y5y<~O l:e:4-!Ρ3#і)Ӗ󚳖"g}悥T0]'h}islfR!OÕ\9 |sx3-O JeXUyn;4liZ)!s8sC\43-YD^^gzʳEK<'59ͲE//_#u-^w֣wFܵZbKX)d4y.]r)Ӻ.zU[=]?[灋ׁK+{t+%m%c)m>^Wm\g]n)b}62ӵ!m +,N_dKFNC%il9P]"`󺠭Z٪}׵ݾT݈xї-g(nv۶nk-a}6CMOZ#Q.eh+-L٬pehI fOkk,'}ٺ6/rpڶ_Ov_j|vзa;W~Nc p˔e^dNil/]'h[,}%j۴hx^q#v8Ŷn[βΕpmh krh(eRJ+Y}ZeQiAYJY)נ-w}Rpr iT3; R1Q*!In&2iz}=PcO3t}=w^g '#zC_b/֗W٫Z)> fVf8i}]翬ٍz⿦z_{~rDӶ0BۇAnԇ;ch߸ۮw~>{GjFi?1 $Fv<|QO/hO_?enu8c|~K_ 6nsɾ |šhWyGB Eݑ쟦W H@#sǑ#WN(PQ@qg"PFdG5tꁚw9" &EZi`8ti`38,wns:N8 ڒ~.q 2MGΝi=3q5Mw\3Ff>ǢvAr`n`utrA6:mq|ig"ngJ0.2vu:/8Ӷ`Fegn0;t&g8t^vd,up ;l۹쬄YF`nY,k,tR L-8R-4 SsSn_!)^u1А,._RGs3!׹?Xe(pc-H4;k e㑑wP需8'a97` 6y*jhr -ΩѠu- s<pDPEcUcq)GZ;1"0Hkp;oxLU&6Cȹ| [\npܰݹQ7F`:׸aexP+' ]qG1AW/pȕ |ĕa?S,,V!ay(ywȳ;>&޽?(§YsQQȗ]0k8|=u}{C3x{>Z_FKV^rQڪ{/nUGȉK^ vkx;q[,yubS[3o8[s9]vh9x̭q1Uq[ː+#,. ĂsF\H.rkxo Y1i@(^0Bw$(΄ޝ7n\Ԓ}]wzZ=\=6iT7cBgLRzQck,xތ9C)ޫtcQPF(Xѻ*0V.uwCeF7 UPͭD`;%e;]^0Y&ם;46wqHkq Ɲʐh I}~!xPM47cnmh4O ]n?b69JwKZі2}I{݆![%w6-WkJC}C2Gj K"{W_Pa֡^ʩJ Fq pO;NG+_s>L=P+CȯC8>>>g].EU[CƮ}!KwOy7<,1Jf]Cd>b±*#X5Y&zA6ij&d') -[!EK$EUz$~1IBˈ{d5ĵ8MJ;q?"q-ƭp4_&Jq$<@6&4yۤ|%095@~Ēɨ#&yaOdbZ.&fL.0c̷73?cx_>R:NWW>6یWƯ|WM&=&<<|MyBfX#变QOȼcT(?`U)o*+٣w>|EPmTmd*sSqY%IIf{g=ϕ2'<*VUs:q휞M fpNNf?}aF=fA>96rGopfY]eynrn~,6[f n!1wbcdP{11ϱGc^{V7bPǼG>1GUU<cN*b&b~H)c~3(s]Q/1x)?q}ˉdӧ+FH#jt@S3/p0*Og&ExEeu.q˵/1qx@e\J }| ||DX D;Q ]ag߇eGٿ#  D؟?#<> {=jt=k$;gD`kJd|r,EH&+R)$ݤQGtEd3`)*/L|*& x_$╣L+.epM!, ]"'D1.f¢X ebX#֋Mb (J[Ő]w{C8!N)qF9qA).58s9՜ٟ*lX7\h.}\*s-0- fd6º0{~s< 603Q>I I$I"yPb J,)TWaԡ]Ɠ"-$AIqGO6#$b'|҃ZA ;dy#@I'$ByI~q?dBy9 wJ7,%G~sPm{8;g*g!EL,}xaK exx9؛_\%1>Ч$^\o@t>z F"sɿIwyvpP(TEj f@+mSn0ي?\gVd**lܧALնapSBa KtSɴ"|ͦٴ"+͛6y:qu&I6dI-2$ ֳ[btɦ-$~Dcf.TIb]i"vvv :=7[m+퐨ˠێَOt6~mR|Y۹kkm4mq6KaջQ>L7l7% >bZ|X{X'V0}8R(%1^1!EJK]'qR"KrO@*K%BTQ)U 5Rퟠ^j?A) X QeǞ ɸ$9>ܒG%/  !)Y g ۥ5J;@s~/ۋ]AܸƂ;ll.rUUEl]E; OǵxVwBUT|MQ]Ex*h*8V+;kܩb5Hgkl^b>:_mkq4O%eTS(CD Pu=hkt_,CJ\/^VQ\WY<@ ~śr o 5 0x7v=0x_>L*qr/\;&hzⳁ--/Dk|XL뤶9PFvVMlֆ{6ӹQM&mM'^зy>~{˴alCXIk8A^ XyzL|Q`l]X({~ u5F}˙:H^31~c:Hs@&-su,p:#c!8h OsW9y-ἥ<| J\y."׹`/MZ`nxWnuɫ?v :g}ʷpQpHx!;. xh r,7_>>o3\#s]Kwc5v#׆HB,9''#3t.Zs!24x)ld#/4HV>2~&D1NM&F&EfDp-*/̈x 3#¬H?\hOP8!0;q%gZ EVΌ)Y*̏Tz#[P`?.T~HmH]ar5&uc"r^%\X9qV#ҊFXX{QZ^x8*6F{6E+l&F /GG GǠ;8B=9>Q[_tz(9:3~hPjtn(-FDk574& F1'Iš貐-Zs@l">4=uBkY&%y\Jo@i $5Efj:afuLu.¤^hjP %ruF]V[*unjUjZ;cZVUրSj֚jzYvewOww?w;՝QF6t,\5A4CEG}߻b;wP;Tj;h_|}A$KԒ5A| _| }_CC5a| }_C5Q| MaA9 L| kXS/7&-|oM&``)D7|o&o|⛨MC݋CTTzDwM| I[Yi6~DoO%'~i0_-냒[n"y)ɗ:iTr;V]4bqiYWU rIU(JR,TJ*+reQ٬T*ц(He2m20WqPf+Nn7a7õsiX=+&J(=)8>E|w4)8P,x8KQ# QziP4Q?YO7A4]0o`FØGhFCR.J3t+i301#M1ou.alHwwm"ekkl)C]6kSr]єtiz5WQ)Uw7e,,thT4ڵµB%,)uum3jRkۻ6v..WM/k`q5:Fm3I4uu 7ob9I팒A(1WG">GtAɦ.w<ѻx5'LFžL"EIw(s<9N =+=k<=!- *Ay=|0wɵU2ݤ9Cɦx) T*f=B}2S_{O{z[mޫD7|ZEզ/咃f=ALMzZUf1_ooAn>U,t-p| IĻ+P¾r:Ff*_`75'W j7g{N/%:PZ5Zglj:gݼN:Skt6BD55S;O6Jϰz<' '=2yee8ŘSLN1r/N.5c{}pf$]Ocw#6tܭΜB ]-2GPH껡#,ajdYBըEPq' d/'K5Q-ٕ420.׷ ;h0ѐn(L#دF{x_@9" 99h_4yiPE\t=FTBTz79(V|99j65ZG m*vtCvC ]W#yt"?%gi%tR7tRAFV7oE:uh~Dt/ɚdM#q. cBquR" %2 w5'~X/;G,NUwfv})5 ZntoUD!Q#x}.ruQN/ֵD`ݤ"ޭX}Қf)kݭlrd Kih%YVۢW'?u23ٱI߳zaI{n_DDG&:{Ih!j;1_\~{ sO}W҅n|{>fQ/mI~O{ ~m͵:3NT`-.XK+u֍Jv.kuzI9%kMoKm$Pm(A-ӖE4mئfZms|mlKlm+mklm-*wVg;lk5Nٚmm˶licgO#c9v't,\bC}}̾ʾ[`dj-oNjDkAgPk_pH/ IŅBOB/_\_\ZhN146gK.Wh.0ϗ2/HVsEis%wg{%2{Յ߫M>5S#,43Q֤x֛y5JU7n*UJMek^Vh%UڿwH,ԎX[N[RkQja&k/,־!$M'`HXYxdId*ꤹ!76 9Ӝ)9ќgK={4> sXJ1/2PJ5/3Hj5JiI[ͭRc뺎!Mѡ|O?Z%c C/$4 >xvix1fy4{>(Of4FwBu~?ߋ>,y?FVE!/ya6a= #|蹗yI +7! Y+$g}D:c& ~$Ly~carhoO2GOAц~X ks\ ,t(Y Fp%#e> ~"𤱈utzG? ͗.­y?Kt'] ?kWп!;&~ q'dzΨh0@3va}'P -ܝ[OX|BҴz=;X7)I#]4.%/FyMBhȄ$`2U[0O,92]Ve6]c B%J>VˀlhMbޙ'Vˀm@σb<% 4Qe|+VMR,i,e"/#~xϮְX,Yǰs vϺ«׀!< "JcCxAå: H:`:`QqwBrV03 p(#"Yil(>D?NCG>dHl}` "sqOX.֞(F75`8>6OX;ekޫG?z ~@㻘^-@ i ?=NP` (ԷLi/B)jUkx5i>jV olNrCO+H=MGyM?eoQKe'ĴySv%$ۀvwvE=7qHلjBqv< ~5Yc1ƳgTc j5&ZQ%ZB(9e[=ry6{l{S<˔'j6jrG!I2=z:Y]\EGXӘK` p"s]b:+ӊy9:PAV |R|+$~Z Z8DW/5x_LBXyEP8W`rAco Qk/%H?7| Џ>d^~|ۆQ\CLLB?QCܓT2]u0ʴMBYD~\9fX?WµSdyqp|_% >Ր;f,~HQ7H]y~xO-2{o;,;5y2SO}1e({8*`-;&:Z4En0?<h  g*vY3j` weA ӿN=Vˀlmh.Sﰄ%XbΰI"~Żi(Z*CBȣh5Vˀd(IM!fS& 󩜈Zj` wy\/dz8)YCmDk0D,}hpm4>lhN @XUnaq/Dxq"C"fA ^?+yQ^qJ{pWT {ϗqi7"c Z-SZ:+&2ȣ{QQP7+0=e܏y98rֆ/pn {9$~fCT zq Ndž` XZ-Mw*'b ^CU' m&u lBoCM^Eu:ѷw,+0hCi9w߁xg2\ LC;7n23+t~ɑAa&ע=yuw*1cy=ʳ/E,M6a˟hgjbY3)F}zySOco{k>SrM=rllzU|ukߑA~39?|}bM=^c3Ȅﱆ8qokrk3ץ'mꍬoCvc$O6<06;#^C%2zS'P7s7l|zezj)A(;0?avyVd`~c3_ vè?1q.{2HȔak>2,UA<ij+W1/ԯ`D? !C3>Aވ^K/泹 XyDF=r^O4mD1C-k61M[a޸иb΀{^T3#5*fNzK>wNOQi+>$?+$I>ǧuA>Vfgn>G7 ~O9n}{ z2R34}p[-yU# ?a3zЂ ʳFK dsN1jjtVIv#;ƗP7a VX6D H64:<\wq^.NaO| (H_Gxc??p~VT $K^SgG1:LBF|&gO?F`sFچgٲ)x #"X! ?L4+Ʃ8;߾x 'Xk6^WTy_&+/#BTT|wLd\J|H V+? FFy8p)?k| 6[`L >/\zb$88={=w2[Kp؁,r6e#DX_/'av 6UpGgx |%9R~q3ϸq 䣡f' oȳIqj a9>I:z{zSI[-y 7ՐgkۀC1![Et8%`8xX¨3JW!J7[k<jSxqxE? vG7^X3@' h< JX|x6wv_,1$Xèu?4Z=m0F &1 3eޝg+X^/Fg1[gnmOElt_=YI95X.f˜qiTC=0?p"wK`%O@ 4Lu>y>Pd)~W衈;%f#}]3x:cz&xLo"dxu(Dh@ո "Pw}6{IQHq%x#|)Ps a` ?Kk?zs'$o>6 |#zނQII[ ܀0 $QEF*,qK̋ր>l'aGTF_nfO5+ Q񖣐#%ȝCݚBfTWs okQ SEBZuz+0tvKuqǺ@^3{X" `ޗ@WQl}*9}N! bdDDDDDL(`@0APdIAe 23! U}[wz]vڵO'tu`gD&vЧ?XKay,kN5'2OtxW@<7_`5|#5+uʬB6th`n0$׬&йÚquЬG: 7%"ȼn_5} to p{z@봛k/ Rii0euQZtM!y0(ZA=A>-X+t3裰'1y(z1KG8 u=m[;dho7@={ ڡV%Hn~Ћ@OO8XKFE`7FvBd~#p>F ZyZ5I7j_<"eapmCr4,\phhc=X-5“b%4 qTO>Dm/&/ `G@EC$d~^U*QMݨ!,4,Ƃz] P9bFbh q޼.|kKBW~STCݥc9^vD[L,l I1.@f,Ћx{v3myqq`C 4t#ATHL`/`x- "dJ_b\Z|Kph/^Nٍ'7 mT**QN~ Ap6>W#P Qx*!? oW,͌U sFlX<0ނ|hDpS#GZ6A !< rye˨)Ɲ1R7bh Wn7p~9-Jm3r?oZ'2 yZ Xx .44(lLK,"ۀn oADtp = 1hZQA=ȌCЋA_>zYi | $@_|-z=<g*Ar ^z2|-Ҩ{fC)VK |#O[z `Ek(EJ;〩|Y荸ׯЀ; :1b '!3ƺ:Pv2deX~iL1hgW(xFT)^NjEbt݁Gt' Ux;C-FTHYL`/`x- tJ_“\-$8u|/ zmo^ \bN1ƑMxsQ\<ρs hFЇ:"" '^VA&Ix#D`A lfd0¸6F߂3@cǘ2F$dBp9dնI.F ́y D| VD(!A:(ٮKyn{ѓDz6:k ^7g1jxoߖS#TuB2hRDfE("mF?ɛ1Z`_Wkie?g/ll1*Z^^5c2C\3kzvCM;ԭ'~Dh>r#$gP&x#28:{8 50^O2&d&gxX4Q'Ls&зශ*V ioCιYiP"$V> v@qtġ90 9dư241Q\%g@~$k~|׌vK3䦕D3[1ϣ_Eu-ka %\n!*uGVY f"|l; >D#̛$]t9{ڑ.wc|Mo}EC_WnO0oj=mJwDwXkH=HdI |FcrcU 2_WI F< 6hO!$[ۙ۲z6> ^9bOweW(] ? h"[<8OA[ ^ |`@?=,yti/A^Q4 7pQh( Z'yQ\6(OFOof2p0wk|X~K\ zd)] W8&+ < LF :vm 0XXvwUՁ^7z_v&޽]W?pp7O~  \C GCt`F.m K_.PXXNc@0888Nc$LRJz ]}=z 4(0 zC %'kOJ:j\OY{eá{ttpto;qіz91ustsQ`Djΰcs񮿌7KGhzGzGInPBOEcQ*OSh?WWzG3i)t-ۊY V J[㬙Rk:i [uE_"&yb""\pe͸34mEy1rq>"?9z#iB^K6:\UIxϤ$Ǫl|eRM&B RuTۺF1UǵeVA^g9jf$ ߰Lް}+JQxSm]чM&n[i HD>!O]./|GCDQQ&Ң4MMɢ'EoZ_A-Z1X bJ81R'(f:j29(չesmm ̓-uZN{tr:Y8=VEz*9?Y[[WC]ˊbBψ7CCSvzx@xPBEq_ϹTQUcTqUR%UIέJҜG=XzÜOSn8*rUIU₪* RUUUW=ªǩZ߯ZV\Ia.:\LuTꢺp zK7\JT=zszP~P{=.aJQ)>Pp95JC!WP8NP5^jIjWRS~LMSӸfjUl5Ps\yZSjZbWZ}52Qߩ︦ZVjZ͵֩u\GmP9QmjϫՏ\OmS۸ڡvpϜ~Qp#WjMAu_PG~Q]RK*Mq3ҹ~:x[#2eeX:e[:{8B`9g3) %"-JRZ:N vN; ;NGtwS$]N/Vq*"T1ʫJORnUFA PeUY*USR95X jJp55Q#Hƨ1R%SOT}JjדdzBMUSӓ3=fYTMQs\}NOj>P BzF}jZBϪj)RߨoV}KurS*<_=;S};SڤgCEgDUgFjζNe]:˾v,ڣ׌j^3^RLV9B]QWQ+u]] u^E ȵul9VKfړe/dFUy}:'}~D1W[VbcY_XED״R!Lթ%R3}Y_W)!M4rZK[ht=Y+݇8Gtr8cp>&k?p=^;]}=+z(c/-cr8cp=J{k8&Gg8c~$t =i=Rc#=?=g>=3D#|L=24#}=YGf{d}=B#||{d)Lxd޿žGR#_Y{[?V= 3+}Ϭ=G~=:#}l=&#}l=/o)k#|l=N#?n#{dG9!39{g9{SGN9{d+< هH9/zG.{+G{$u#7|=[G~=rH,#?V=L<g{,_K|Ui|F;JNkn`u.?ϑz\q{#wwɜL܋{+>܇\(] DHyx9o#GPva>;ξ.bvI3m {+L][wRăfot ٱX)kwvA;-_ *Fv۱h;hvef}4u]Bv5)]Vl ^87&[Gfg,q]3ߋXQu|git9Wർgl}.5od Y[Mk70Rj~g}z1PDtK]LJhuQ4Y>G1}BS='$LSh*M:|F3iͦ94>`>-/i_Re-}s ZIh5}Ok9z@6fG~I?3_h}_瘃t~t1qNI:E s:\t.Jt6Ntnot~ MEal"Q4ExQ4/fh!ZVeh-ڈh/:WEGIt$Etn 1MqP8*8)N8+Ή₸AqI\fW\W5&tqC[w!nL%""[ =XrGsCNFܘ[pK~[s~{f?nW1mb}>l }>m}ɾl_4n߰oڿٷ ig; ;e5Y]>-kgdM%k:9YW>/l(e#X6/eSl&l%_ֲl^:5$ȮuM!2YdoG)۲ w ,ߓCP9L)}9B~ GQr#?c8X~"O9QN9UN )r\$_rJ._o~r\)W{F ur SFIn[r&rI?G~y@<"ct!t1t)t9t%t5t-J = e"0s;@X` DŽ  dž .7\8|_8.|HhXxDxbxRxrxJxjxZxzxF\<}>BgPO:z}^ni? V_wz{!)?k~=}4AuvMPA-eP>*n{M5t]v~(}= +2#w5q{D*Ѩ6+ Z&ZmPA{GI.Ġ;JJ DPx=vkII&-j-R ,dj'5 kпnOe;AvoȬ5.Vzeu^#譍}5Tqum5jzXM_}k\w4WUKc 9+ /H}Nu3+;';?T (ݪa0$ CA(YD f1b$(I@1b`@ň9 bN=x{}wU=MOォnUP]!&.j :B]aP_h 4mxKK-[Q׸KK2/Vp ೿u(4n ~Ǵ"c򋿌meZVUSlDgOH@ʪB} ?spF0s %L5 s^D20F\$b1 D.!GsZ"☂1g8#U:{<#eIYL~$?B _/Py,[[y9'/Wxx) ᝀxp::kۼ0q6@ CJ/|CX7Gb[`-߆oOg4߁,߅<Ë@~ P~zIT8oRQT,ER=*J((P`!!.H W iRYRo[P6ϸ ѝ{tAzXQa-cnUwnUۨl5&;kh ]Qp WxM-#UI5R IMR&uH]G$IҐ4"{Ƥ iJ24#x^a7Mo F!|')|s.|p>q>spZ9_9mvN>.RK; \kY|GPG,i LQ#A< CEg  i?DEbQ@ P`"PPQAP54FUnxuLw4^&@ j㑪ap!Fc`)E]՗N]L.~ņADzqopF$ֈ]0z{ $^K %PېF;=@ 먉uԦSOLBz`MXS+5(?X {3ťE6:g__9FbLY/e0:G@ m8–E`->&]x..|lI{ [G.6 @|*F2llХC eb@? D!1$ LDdؿXaWaE=`?p= p8"+PpE6ps882x!xXDBA1^e Q46]î~IBgp\W9rvep>8sCRk7jQo,`/ڋoףv}꿃?0CqqH$! qH !9C"C0)abW|i $8%< )(RB3:]]8`*.p\ѷU <OË6=G 9BFȺVilae0~m` b9b XF(h88eHG/v>|I@ 4BPGqv2lPր @q, n9۝y')-Mn!d0;iY+Yha#f,C,G­XmXFXXFXF]XF5XtJew,XkaƲe_HXbUs%sses`c/Ş[={n<"2 *:8\iWus0V<ҡ4 IxM>0CNT}M eٳ@X'؋$\3dP! (/lLSp Ap( P}&SyD'Jt"ZEPTZ:BQǩIn Csi4L}ZTNu 9\A```RP%+'/8 4   ^ ^ %| BJ BfBsRh%- mv~B{Q$ tMr?џ/Nsz88#s@1mv I4ߤqV&rs9V6 U*ׂxU ~sz ،y(vA9n`ʸ`=q±n}qñ!8vcPA;ABq#tZEH} xO=DaklMIlG9lG5lG]1 k5%[G7@uݺ?:,)0ac*`*b*a*c`")Ϋt~ q?%p?tʈ@##''K7#ld"Fw2"c8r9Lhݓ6hcڔmMm~Ht$M t"=O4z=Gϧ2:ΥWt!]Lez-HW[Nz7]I(}>I % }o ]~K?]sh%d&Et+kM9pV|vL窚F:tŽ#g!A 薄5: "|"!"V%!ԛiX] :zu-oӟ ;Si] / ?%wŏ e.lGĠ2/J炢EOEҩ߷g{qo;(~ڢXX?~OB\` ʀ.zd?U{;o|;"D"{@6@Ng(&PA\+ byp7|>A[#j8fW؎>G<Ԗ ا R}2ʱ 9BEVbρjZM̍ebjmDv/`hb&& B."P㊟8}N%UIgɆ+ndn2GoF: 'O"gQ{yo8A#||e_Or4I&HmPjz6Iՠ}1UHwC s9b1|B3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1@D f"3Lb&1|>ȏhOד{f9'i8mN J24.gBF4P%ƣx 3z[0Q/6]O/ƁDQ ;.'ʧyw\fv|m<:X܂ƑM}p4ծ|eeOwnd9j|=mgY0dcB2 W2(Ly|oh-c焉cT敐j!ikn.Tmwnn0ՙ$6n\{zA^/L- G3$h jЈ!Ǟ)!l1C:\eFqŧ.I ֝FێZfs3{kؔ>& d`4:k9>"e7^ND $I mciiipF^oӀ䰽qCų4߳VhYٽAUEJES~s(&GȘPň1*)}|WhDI}tV O86a{ cjϿs@K4wNؿrrϟ\=nі& yY=}1=贴rֳHcF±syzfxegSsgrd諝++t{"o4-7MQ\hSǕ {`0^['e ca zծGFiŌAg,,̘?ds L˾&Zoտr,l_Kkb?ϮO>qrv=7Jeī`w}ֹҰ4QR)-ҟ]>1އ7\?۽1o8wݢɳR\6֡#ݙjN5!t=-"W{/ y8<) |C.}(3r"}ݺ.S֘DxiXISZ]Lf{w`,V޹G '.ݛL9 -cY.‹5.̀?ǜ\liciX0m-cUtEcnmli.d,m-~3ON_ޥ8mbwP>՝ ^ s%D}dԉCkcs#f0w@O` /Ν;[oݾ=l8/9Ƭ+撒FN'8 7/{)h(tr~멋_ϓ=yM FN:vhrA܋5o-NJOz+jE%Krc#.)VrC8;')~=d/n^* ǩ y39þjBVx.^Mj0ZYK2R.?p/g,U֋{$B-)lW͊GOv6iπs r%»N&}b̓ }/!23؅b $e.+(r*O;%xGl}C?71ArW\t\DXJf)q),!oY26fb33iffbd s5xa%-g,̼yё_g5PN|^mlzգ[[{:T`ay?M{iERKȷ?T1Rb-$Ns~5H0Fף^BE+roXZtWڰnţҧ'q$l]fRkdeȊ__q굣S.l v[eIoLx{̧UNªaA貜w >xRS/7yy**r;4.;r!ca_/AIfL69O:}[+FYXq-:v!qhTnY.՛|U紁Ck:iAVCE##nw .MWdta#` #ÓL { 8}es=W6mV;C*k8{ԵD{j#&^]/ؒƜ=ʹ A)V[29z>~ck,)HY#7:eMI"yE}s|<tYs9rl|rZgjEуӮnɹRkπ }CҬң+e7v+Kia L8˅޶ŻBʕ. \N/G #-rsE3:#س]{^ћӸbdĵ\a7 8?"7θ2%N%}dԵY~) ܅bZ+Y6;`Wr;Ȧ4=͉vjMǬwoibP_:͂3OūuN^1]kx}e ')}{rKgn*ŝ)/4">p*ܫ6DZͻW/na[Og Mo}ӓ~3\rR1r E7[ P) ߶u~Iɗ^ n[awk'\8%;D͍rau RnTQromc2>2WFϿ-s'}yWnT7Ls/15j6/vS ݛhK[l\h25)ϸʪ/"Rl˜ؙQSGo'}TwޅQ]ŦS]/wJ Un+0# If̮G W[1VFBlKsf7vw/wܖNmXtJo+{JҠ)l5l5e[V0z7'gJH3v?c;^_'=Y_/H^6Gncoms񡾋Iϊ9^C|8ZG-YŒ.)2z'ZyS?]W%r^ ti>ތeguX5Ő 0_Û?0./*?fjk ig 4ح!kKx^ÿ3y;zoBYw)B_)wfF4bM{fw*L!Vڜp>g0n2vXPILʕ-L $xjWޞ|F 8b .> _6\LYnMn{mZq֨kke<]j +MZ$({-M%T+Xi$jx`(YP,ɮc6%{ [JsF#Vj>0E8_K Q!à%O_);M=O AW?ڨ<1UY/M5]'{Sv_>ŲX9T±.Nv68vct LGZ=lf? xʢ}gLɾL:TQQvaƔZ.mY> uNEWi̕$쌷-zp&WxWdo+igIxk)ǡWNk]ou*)RWh̳uya!J뿘ۛ Q}JMECAǗOX%9baCtl 4S ~G }cr{r&˿t}0ā  d4H$V,H/՛5%=)1&9,)6OAmؗ)Xnl>nAk{;^=y8~͸0BߤI\ 4(5r:bХgsۦ:+TZ^(wj7l{a{qB bK͟imnќs7Gڏs3I˫*;?_ih5l9/ Y -oqCW_JZqCg\NNXzmLR>o3vߕ+4ؽ` PN-2 )\:a;qXoaA " DBT7`Hi2@9Ir#eX 3"&& z*yU1nJqkE+Ai%au}in5dGj#v0}׍,=;oMlo6>ڽx'ٿϳ8'.Da]wV{D"'wX\ zЌmYi[9wAXjt~_xYdg^gY\3>zɎW>MJقU2=\ĂW0u5]L_忹~^ùV^SX> stream x}M@>&Pҍ!Q~d=mк$+ă~z{uMrq`OwyxY~ Cm=_Ѷ4ݻ@_[y"dM|>,. j{e{"rT, I^r1Ko?-#IJ['0 МI-AK\>Iuq,#3\s0C&%h RLYba<C%\E葦EPNDP;<AA$@j~ (l^P;|*phXe :S@h{Os6  OW۬0 NS 쪸O3/q4L8gZݫs}]Ie*@iZYrAd~+ (?Wk GEwOa_׭S-^riӴcv endstream endobj 239 0 obj <> stream x||T9۲%mݰ$$@(f!^RRCG]P7 H ^ZU「P$3@@.I ]tU6ޫdLaXqIO2彅_?bNÀi7Uj/LټUw3]k-Rbd,Ь_7dL8sy133c /d̋mܕ3wiȗ4ΞQ}TOFy0X 󖬈<`L-w{xw-%WΫ[0ePQGy͛oz^1 /iw0TQqŸ?[;p;>(xn4Y_u֣GZ7F|0Jhcm?evȑm_zԟŚf2-( W JUM6%Vm>L&V_c)VQh0v}S0Lc߬{%t=H1Syb4U<[scISvhYi˾b;hgױ)߷C3Fۡz:Ѭ؎ˉ~4U'dž9i|lп7W؀{u;I}Mm4Vu:ukOQ6S?:ɤ>zzWRمvR?[OWGv߯Rgv:)wKm;]mo;M/Uob]-g?2䤦vгuݙ:SgLkr76leמLfNc>S?CﵘcH?l'>'8,;0Cw3uԙ:SgL3uԙ:SgL3uԙ:HUALНy٠, bY1ƳJ6հ9l[Vmnv{;HKajΰuFǙKߘ;u4I=%;7o "u> k6uI5UʊƎ=jJK4p@~}햓smVaU,[Z 4ûڀғ&Ͽ(0:ՆT/7F xe nB&<6Sb W _ 免ʓrT^@KA(EX.XCaSGbO;It wKJK])ޑm)ޒM),R.kR*+R,KR( R"DOU %z';v0v-7g7^'zJ _&zEDϑYg&zI'O=J&G^r&E3S c&DOtDcp^{; 6?Jf&뉶]G 5DWmUDWRD]FRrMDm 袠ta9tALyD~1_t%ZCWSsV |reDK-"Ag=hu6j#Kt6YDslY4|Qլ'NTGTK4h*Mz l2$t u]M7"HÝ@7S/DDDeA4>wt=684&MUF :N4AZPIq18X* :փJAC|DDQxAWGT ګ@}Po*EzRAX]<\jލCMu%ʢ22҉҂vT"/مL<ԋ(%%⃶)m*(6h!r9h%$jAd 騦jjȨ)Dڭmzw} (pa 8 w(C7Aؿ wK YEv| >]w,=o߲uiIwxuK5U Ky_~9Yg-sXfr?O'_~\1/r?lnt3/v?d^ {`؍]( [hMVwָֺ0us  f:} 77B߀G_[u] \\ l6Wݕ Xqˌܛw/5PMs_n____}ߴָ֌ZsΚk_WWپʿҿܿbrCElro~R%KKyR})WRRRռ_7o 4j4*t%}-EϜ? S0?{,̂ Z)ۧ''mWT'J{_?`,c FGoY0?bpR &mD&06#a.>::0WߥFY J5 _Z^S|qY9Wc?&V-e1OsSYbCsM/:v*%n'gCvUbrݪntG*"{-ZE\-j10 f u@-0 L&&?P T@0QH`0%@1P > @? z|'@7 Y@&i@*)p@ b 8h 6 D #=fH;*`ۀVp8 ~~_| || + pxx .6&g u5Ue%Ey9Yi)I q`?(0x {.`'p?p     \l++ˁˀMF \ \\csϱ9?csϱ9?7883 883 883 883 883 883 883 883 cs}ϱ9>{cs}>S{)nT73ֶkggl=~.bf{MgCme؝`;gNm+Yt,#Z,xNXm_bmsEŌ XG~E+C[C-@]հIl2jYf9l.rQ6 יMC-%!}hdKR ? slQ(- blM̞a`ȗyDefȇ ՘FL[~[k1w1LW~^~5GMꅞe)s }bF:4֎^9U!TװoUxU?A%;o>^w[(݁gqWHI&˝weГ fd;.<ta{e/{ yI~ [ ({yQrϰgqB^d/WȽ>k g@k+{MdC!F6?ZJ7pL1l,0uݻņnG*W֋|VbٓP[Ihv7!-l֏F;>Ol߾bɛ)^y*3lLVT VDoQǵꔵ â*qQ*& Mҫz532jnI$gLRL[FNyH3U7`razѠhtRFLF4h=Ơ3'^L}$:W~DV`]X:i/KmrG{[".I #/A4ZBWsi8Ǥz~0q]F јfV>}իz^sTRy_gQMbgSUȲbbt!g)j풞ާ/'?jf͂RĤ4+79̟Ԩzs|%BthHM3CS/d swq۬b%Όs'e&8}(wPtrDQ9GTsD圇𙐵 靨 >fK4˝&gfoRL ?O ^-Ԭd CϛIi=&svv?p#RMޫO~ 9Yr.s qFӗl=k%m 5#O6W *J*МΩ\5&rXAw|6;`\ 3id;ـW^%Zx%;G;uCud@.*bnܗT£ʉ+'ځ9GGaqm>rX&!웄Ios|cFZxzVśrEL'IKBa\>Cw}ziwyS^ 6S'9/y>x_2gKkU؃{j9!=Z(:U📍S;.X].da Y؅!<{c=V.yj2J;™q'F(FoQe8~p0;-{@6GyމqN6C#,xAyb.&VQ \wM!:Y_#j7Q1xgZܲ!b>̇>{]qtO˵"S;=~m>fݢ7U x\[jNtޙ5 {kv6]3jubk-!>$;rf17pf8bOY(T)XrA1ךRU2rpޯ|z0y <kRLMzm=CE1DQ wOӳGW8Jc8y[!,t g}[9":%^K]9Fg0qJ-7UnqK@[8yqgl%sX}xf܇+}ɶ\{_FW̢oh}ŬOO Pkaî]c_}L̵pà }N) > SD_x>v䪿rILlccbxt8tImpY{ Ixlw~^2K" m 󯼻~^T=zM,pkUKECf8GۧIꅣumS)4Z4} 9+> hHuCgА(9잾hӇujԞfWhf4qzH!N~0;̜g}&/3hQ-ܼ{qW]}}hͥht4f$˺eK>ecm1 $/@!ec&$7 K :6e;#==WzUE[QTO&b#yꔧ&H).{Pw# Y?ҶiqM .P3adViu?3iW4,(Jmc19X묞~5+B|,<5sjZl;{Q&Y(.l&4W״}d]$ZsܞMkG w+>`MNbW(rXjp%&ǡO֟3sg^`zUΜgWp>ۤyA\2f)=(^HUff BET$@AQDK݇OU(^(@*L[IyɝBdPpf*^wG=ޘfߥ?f Ψ_62))󖚕4 TĨH͠(9P Lx2>McsXFe~rmi~cIi^DQK1Y*e#ҩLy.0Oy#Hׂb&[M2Yo1J*{3UqT;i[(58K1`N4./1&7 fzkaL. ^_w8=Ef4S3#۞hgj[8] [-6g<6t背 Qxe;(nr#1*Sd+UMjUjk+Ƒ+c|*z[^ TB֌7 tt$爜H\ (x8Yb*kQS'{%r K6dڬ5z&ͻ]N+C][=k՜Tʞ* /}ڕ_X۽K6u:tKӝεm{u@w@| h_r[@=Ɵ8) uRLGf\vb>q>Ɠɨ)&Ygq=uu)8= ܶTH΅ [.$s&3H3\!;uwGVݶ8vQךaVp}Pct#N5S5f!{Veٻ/nr'Ryn=&d^ G ,[ӆef!=4˱V%%}YXG;1Wameece#(8/&Kbѳ,bYwP fmPsmۖ9VJL6&  rіp0TvL>=a>柦!ч`VxxMEFo; 0ŚjTnIY =+"ul<.bl3xo'z蘺X[7;T] `%_y])'ՅY+=Vlx& xyn0]O> NS(.sjՀ2Gl0nW߮wQuԜ&_we7=l.H*3xZbTOcⲬZcϩLhڵ:ɶpfFOҼB?Eؿ#2dx+e -J ː7hdvpTd#B,zVHu'|1?ᎌ<m[0Ta<&Z'.1ɢ{eOmw k9G8nTpJt]25r2%a(bؤq E#m֝E^!ucnn]EF?]>+8ޞ+V>NO9 * Ba/U zG: N|,rQ  e:L(̣J"PRJKԏ|ԇJ}(lD;ȏ>j>Q{ "=~G?5SYGg!_H|Z18e尙mfv"x"}B [qf, 1]6I˪5:+\YA, j$PO:u:wjUZ:AgS`l5tPc(C!/ yP(¢(PS#jf-hj|h@\y<7H&C~337yn'xkxtʯ+gCX_bNI'ҸK/.IV̄`y)0z[-s'haFza 1Xgw ݗhIZ-{ji/ݢ,2Nu }Z=yTj-DNzH<^e}U_K~9NŨgū&BdDת;Դ:hW&.o<#^v\(?7ʠ+ V`9ɯ)y}R6N@)G)z12n*j5g_rz, W1Ad2NևЪ t}$\i^@O;I%^ۯ,khDESѲTd,Z`$tT (rTftu _P.ߓ};4enPQp NW)XĄ9iPmnAiB*K XT#FAQ7PsR'8Τ$叹ZW;ZGZrT8HHO`eU镺5p f|rr_ITc]:g#xũb 5;oL6Wt%*fK_`c*)UO*J]Tf€CyRHIv{Us:!V ⲶK\hYFOP(SSwL4JOA= oߐjözBkW*|q=UJ?kV/qm}[a Xك,%/ӹ agR(L>.@[!Ȯ0Q lr]̟AV_TlqVAzn˽7XެW"=q裰 y&'<?ۨU0bp`#XڛtdYZdGS巤T0ڣw,Cb475yinS%g_.Τhp*>+[ϯb F$Aނ 3w1\3,Ғ^a:J'jllVnJ2:Spltty6諶ӎ-ZN90?Ep=@Dv.mZ =g\.$=QL.Y2j*x ؍ o( *C-9#-w.WjnT/86#=Ŷ4FiTFqzVHv:WP6S(vM59oP:?hQBzԼcYso#σ1:1HGnXAN&JOn8ee-A^{ݡLAHUkCɁ[Fgu%{gh:3ZDz7|;ۮjVh6N^e0o2nLuER+|uʡ5x|=) 9A%qPa‹8 aݸ\R+͕J&F<U~2iqڑqE6FH0$qڞqz.")h4`R .,Q.76gQS_(8%"طgWCsnU]t;5'4u-\|ұdd^XR K̤a9¡^2=5S [2r--^͍eUW޽v՗G񢍮M}mJ-n^dU-ޛݴ/ػl-kxg-Kv\7\ژ] .\N//tZ՜8|AOA$cԹcZ7KƱwG ]90@F 3Cv3z\ MȎlbxJCi.*qa(zat_cy2q#{`mr#7#WyrmMw/ᕋ}w~@_ypzlnj,5f0_٨ LiR7 P:PȎB6%|<.ϗxƪϧQ$!)眐  ,D H{sp;m"o;d=ڨ3XJFc}x]Jp ֒J-<޴G*]lkTF-׋8+ycfׯKJ"%*c1Zy4`[66uzV-M&ݠ39ˤr;}W.O{u m`K#ٻ8nE1 dJЁ^ lG&+]my6swT%w]g÷Xqr"ܟY?*pl_$E 2gcp36 ɤbr:]?PEdf8"[mΒVs_59AMgh0|{lo Bp7H4+?jȘCQ. u`SDIǪPj]BUxӓ2|f)8% pkW|&llZĔ6q:1$(yS&\6XuX ($ Yj="GՅ2L>%\_X|̡ʡj+/fiUH˼ uw%:kY&lz}EmYѰo?}r3MZ^Ncߍy+;:|ΛPiUG0.%BқMN^X/7/$)FzKVГif_.Geڷ/&nKзgpb2&~L} IXw$2r Rdm%dZߢ]34C#ϗ#Q^@{d (t?F. qqG=Ce1:˙'px'V_?A?.b.mm)e]Y=O< ^ RF6BG n#%cQB s5,`#>ǀG?jh;6;^IyD}t"&"w="c'𴈿Eiq+Y,upxVx6mP A\mPt"+sd^4e6v=La|DDv폕kx,D K#NǢL>黙ꖓ ďqL#I'^}"dEk?4T`F,,B&KT7i TVPdwFm7A@`1Q@sGulaK1Yf@\?IO3Aw՗kEYf8̏X>BO#-3-U@ - LC-1Sb-]Wei|GWE߾~c&kZb$XU6Ob+v>Yevyt~_nƨx%Y^%')%Kk _EOL0Vt+?z=)ݷAMy,./Kw*)q/).Zp/)(-O[R(vW@[VF~q[Z\R^W\宨 eeEr fYW(+T݅`e(𖸋hW1]QE|^?JieIe( ?P~nC{II:*t]\2wP=CwIq*/tb`AUWa^S.U}*_b,b Jhx=1bH^:ohK[ c%E%@l2M/9) x Jb7}WⱯ/+.H_XKVuoW̉׭[^׿z/XX^0xͯY^ Jݕhn/f PZ [s.%0?L[U[W2_Ie>  \(C`;vy&2x4OTSU-|Qqa`gKua&Q]Өih&+|" ;|]YI7Qkc +}m@YUP`@34 0to*)l Q'ovSu oO O4~O.|(#M.(/ϻ[>1QIIRu寸qgӗʋO3)Lb.̆+'<5;|&[Ħ;Y6V9XWacw 4[^ƪ'q2?'?|wD>p~-Oӹo-wq/~^7J?@62N~ȏ07K\R%#%wH#8y!r%$IZ&o G)m??˧]s3kg;Y)|>d+|l=Gi >lc  >>vc­c)x||471q|:HCG*>2G><#|c x|< >/} q |9Y.?JrWucX >G5g^h'Y;f؄įׁc |*Cr8>?xE)Fc!X>VRQ >B >{Aɧe.wOgg7c)V`>c)|< >G;|>@F|LsRkFI2?}||d+y ƿM< |䁏2q0 >a*ʝrcX@gLcf/||[SG >?gO_V2q/ |>Ge%rG˛qfy&X>ǽQ4x|DGHG:X>Vvs283{O7[5wJ'c/x||>4ݯr]ҷGǓO>>/2IQ*"ȷwȅr9(X}{giGG˧-re%K>cU̒'T,N~ aMſĴ 55kj[}}W]]]H(:pM몫Ņ@W$55Kȼ4iqIA]}CNӸf߿g~CRp?m%j骲+ܮhTPor;Jiև܉iJٮ`]ɺCT  Y^KPH4QץXbA&BU )JU}}nopMϽ" 1!PHPߏ;EWEmp0#\S g$ZePMQv*1z[].kHPdmsgeڸ5kC\XH\CLY!zdipXͪi:B\fK]WV%ED\L44ФphtH69X¯if '1јwX,gjMn1rDJKl'TfgOw_YkPcha^r65WT4MW6+v@1܀2.aa6!`p;. :C|.  +c/t A}@9Q0? H??c9Q٘ͦA,inӄ|MEjl"eZcDO0kyZAjmvnsq=xC$ 6썏?oSj5{ChKB`˔ߒ8̦6𔭦\BjҨU o9Z*f D;|;2v:?eY,6dm WF m[s,T b:BU]0'M ٭.\ʤιjL+!Ԯ*EѽJpt $f- O0p$xjg#;+;k\HHT+QAɦ4عdƜ)r›B$*!nؔy+yջP,~>-6VwS鉈,hzsMϢY3KԔyz5 L-p/ÿd/uۘ.df4b'kא9ެ"i![ȵN.0Ę9FZ]p.@Jfqcٻ5 Gfyq65'bxbl\p2_ FZEjэ\j 4ڲfPC8OGGR.0pɘO$\#j/tJ;SF#nB[GKJb]'~)gQrtQTg&#Qk ߤ}1zd14swVo,Y94J9(%7YɘfڭcCc];sş Id6*+PôgrTن{fyӾԳp՚-=w8,A L0q&YpqǀpJ8!!~^<ݯݯhJ8ԅj!5B5,O0=N= g!34Ce8wNנs I]oHJ̢5¥͢:n~.OcN*w /;S+sȝIuf F9S[̠5.P^Sc,12 wjq]?o!߄ܵqBG~{b1-/񦏇X< 1+Tb(  ;G]=zꃹz$Yr N.9X1FK5djTT%)僚[mdwbQ'wiԛsUM:m8ptvvG|%i7{6D#=Ns:XJrmPnx3Ke:5655mڿSӆ#?q'#Νl?>y#_"0KصO=ԴߙmچuM?4䕅y~~'5  B!M}ưl9ƨׄG>%H`ˊFg)'ib"nCm ᶪa \ԘӦ-9;Fe6߶Z'/^N7 ]DŽ 8&TxHf D =DM64)ʦk]wEg/nj54/VDEt|87ݥp2=77'׼"3liCxjl]wYabR&"MȮ&Lesrۀcmf48Sm|8*BbOLU)U8UӋ7ԋq>&0-mRvܔ\LIɀuJ`ImnvI+Μ1|,6` 2ڍdh# V$%tBeJ.t0n!Ƃ90b%ϥ5dSZ֧Ӄ Mz4a=P+xڴ;7\al.[)щқpEsP>R(zcvI˙E,,c o[2 {(~0>`)@"O$|b|gd-nqn2w*Jh!))L 6 +l7OQ/Q} e RBQ (K}˃M9'_P[!-$ߔ{ Q/uu٣A~1\6ٴ1 ccϏ{ecBƶ;S,& [HKL'}kC׍a2d攔)+TM}ޔSdL2 ~>ޙ7|Ɣf".Ju((| Yf흕>g9佛Wͨ7Je?S0gdNF̜'!,j?BX5H C ߻پ(<.:5D ҾsC${7xoqDzc[Qnn#gK>XRϲJk]c,E+ZWM<_X6_N˚IkYn5Ϭyí5C'g*XErżo'?\VYWʳk]}Q5jnUnUGUVVVKխ_w~Yz{]y{ؽ6߰w1kc`s6niզ=:7gnl%kKGW>c˹a\u+O_;BM}"VPKXCJiaGgvaդ5XoeP։vAfqs(/Eא? T.z$yQ5)?"26IOoʧiWh?DoE &[KL6M7YPT~Uku@P͜l~ l6o~-p?P<l l~f=t636 ,nnbF`26]i@ o|cnl'aK8pGwV](ec6#v"1ХV,Gulr%J)PZ(F7z(`Ӕ_i86Bƪ@@Gj=}'l4]sj> (*clN;IVXX,X[ 6X[m>-K./totorq߇u0Y><$;lbyп@^CQ:ݏB^[4DhZʠe"LrxW4Ax$zϋ髈@Б =n =AύX&,g,,,,r~{M;$|$h:Z@hhLo^o\݂Q.es$be!j-w:`+]`^7Ca-8u7 8믳ans# @/?yE;98+`aO+qO[띖6 "1I | |O3gY}tuks`HP ;\ X5 * p؂w̃=q>? <?]Fȋ9R1G*Hz #sq'z c>ݟgHcn?Gs|%@ڹd lw)lX^V oi7ˆeF`XfeF`XfeF`K끥z`i=XQ', t=֖|^ ߇D`5XMVD`5XMVD`5XMVLvc&1ݘf1ƬE0kV7f3D0{zX=`vn0 Fb,vXyQYd {(^&v!6)M8)>aa˱ObL>}2d*T쓩'Sm앣W϶g[-sssssOl|>f oN ~z~79}@ >:CwbLޙ3{g*T읩;SwbLޙ3_/v[{s-\TqRb_Kt`oK6ҁ-o[`aa`%cKw[``SbK*]?|~?f`X+10?C6X0NR-yˣًQjŎ <=oi>FmAo2;PJd4 FDȟM 9h MASΉQ|W%@)P5@['7d^,>,:5߱F;]6s)qw 'уSxy@oDA8S{:ꗰVdtгPl(z6= EφgCѳPe95˨ 5]BMjPӅ.t 5]95E1y-t5DM'j:QӉNtӬ9٬9#Clq>[V` pp;f͎g7M"ޙ:q8kiz; D \LnSo4`:0 dM@60 9`!p X ~<hv?v?? xKyW8qoԏ}~' 7j'_8A!˟ph  4яXoGIzu p%0 H@yL?O+?~qiS#[(ߊxޮ~ @~Z FWc#5@~T T؂yW'!}'/Okޮɀ `p. $ \`ƭaƭaƭ _C5_CT`$0  \ A&'oGL`esQ.B*DF`{|T񕙐dVmzo7{VZngmPZ" EZb֨ZRjX L\HaL2LB2l=?>]֬Y|~k[0sO;: z>'#(N)8i8gLq>O\OS4>||EL—pB|5Se5'b|%}) ͸1߽­n9ױo`%Va5E. m@:'P+ uBP+ uBP+ uBpg%/%`j UױQp-ފDEexL8$*++Es~ysFKogE\dEtⰽX^gqt뼷Mo!JwovE튚k #<ugVEVE;ᙥ3Kg]BY q0\|a8GDG(DqNin{̲fQ$QQ(B<(CXqQiA 8Pa%Yb%Y2Xá#>q}+Ӽ{'>q>O\|9k>b| %3+]nݒe 7vGC\ i׫߻s${(l]aBz4=Gڎq(1P'8v0~o{GgoG'_';sM鿄dR;3l-C\q{Ȉ-#2bˈ-#2bˈ-#2bˈ-#2bˈ-#2bˈ-#2bˈ-#2bˈ-SB|a2UZ8flǰjã^-طâ嘊;rߵMb{ثž\ž\ž\Ko JoL"Zn\ˍkq-7Ƶܸ|Tr:9Pi|2hH gIk /[RΙS ̝S=㯐]CkZZZ3L%g*9SəJTr3L%g*9SəJTr3L%g*9SəJTr3L%g*9SəJ Rh@+Z)JVTFB*x X :BE?yw{> pF׾pƾoɫռZͫռZMԘLԘLԘL jTPԨF5*QA jTPԨF5*QA jTPԨF5*QA jTPԨF5&Sc25&Sc25&Sc25&Sc25*b0$℈ "+›E8=:F+賂6ʹiX_!_!o,f7Gq4Gq4Gq4Gq4?zeqWjwf5e3C'q fc~*܊6ezcX7ezcX7ezcX/ebX/e~Q2=/S#cϨO${wMݤMݤM{3ƞ1g=cc{3ƞ1g=cc{3ƞ1g=cc{3ƞ1g=cc{g]6RM ~G.o07ƻx׹-qnJ))*TzCF5e(kDY#QֈF5e(kDY#QֈF5e(kDY#QֈF5e(kDY#Qֈ&:K$UYśUp* +[E2a73̈Y[ŻU[ŻU[%*QUJTUUDU%*QUJTUUDU%*QUJTUUDU%*QUJTUUDU%*u|H\o&F$*oxZ/twOxS/zGEi|!Mnw؃o5d;:؍2&bE%}{(ao쑰p4&\+p%SpT?51upF܄aH<{36+te{쁰3I/VZ~9z(o-!6sS-,u=#v/^ߋefY"Q2$P?Ł0p08,Ѱ}4a hGþsCCy$>O3,y|_$| ˸\WJ|?@%*\!~kc\p=LǍ 3‹QBT{( ȥ[à<΅rÁ|m5d8Ygdr 5d0Y3L 5d~9稟~9稟~9稟~9稟~9稟~9稟1erY\,5erY\,n9樛n9樛n9樛n9樛n9樛n9 ;_hz5ڏڝF54qLv*ZwҺ36S2?-2?-|x|@a hQ-*E7GM.qK}\Rǥ>.qK}\RRKi.RKi.Υv.sK\jR;ڹΥv.sK\jR;ڹΥv.sK\jR{1.era \@PwuR7K,uR7K,uR7K,uR7K,uR7K,uR7K,uu3@ Pg:I:û:û?m>/)D12z<#ì8GhL19WJ|?$i=LaZzô0i=LaZzô0кF6*H*HԈOon~tG7?͏n~tG7?͏n~tG7?͏n )`i )`iՐR )ՐR )ՐR )ՐR )ՐR )ՐR )ՐR )ՐR jHq(šRJq(šRJq(šRJq(šRJq(šRJq(š?Bͫ4ҺMZI>MiiqiiqiiqiiqiiqiiqbL1-ƴbL1-ƴbL1-ƴbL1-tY>L|c,gfdڝ#SvՓjK"նUJwifYsuGΩ~OB,>j_v~˾~/e_}([c9..mm˿^l81]s?A+y=E.vѵ]tk]ZG:ѵutk]ZG:ѵutk]ZG:ѵutkSrWNʩ^9+zT/ݻE.wѽ]t{ݻE.wѽ]t{ݻE.wѽ]t{WY>iq#nŒ5}-^|M^fV.L:gdO3CV4: o#To Z-pExM6V7=Wٮ bk=np&ftGc=*5cƞ0BG%83~Z?gଐ%*B:qEO\="#k¦ď'$fβЉ*1wCU&z~1Xv'qCؕ#8VcE[1%k:o&7y# á|\+?aqO U~{*;*}em|QTTNVPuU[B,59HAJRrb R-l`[(JV Ql`/{)KV Q` zK 2Xbe(TR )5HAJ RjRT>(K 2Pj0:&l[@Z9Bʎؖ}y6-ݗƆwO˳aE(2?Mqab2)sT{JOs?nﯳ_+ò/%=UXvwwҧ<>˱WCO͑鎎u>'[\aH=6aOSā>GSH NOjSF":Bf Vɘ5>VVmlmevٱ]fl[eVYUVd.9[eBN&dvm.;w{},*fz&7&uЧZؖ{+gby=48)֨5Rtktm.s׹Ξ:GaJWDоP5,rK˞R WscƱqP?'d=?˧ijCR{ppP{TE@Kꯓ{{_,QlVbN/+lD=b#mƶp]yZ>*,*/B1&?St9a¶1(*q}}}9*=JOUΏYӾߧ=j@؇>$~q_b_e@o[2`CٯW z@A;Αq9}eūaelY Oɂuo[aZlcK ocK=n 6.tGsdKM,e^mvbzBԠsܭ*R=jml{aYo,\PH* e^'ԑ~Γ d⇆üw8h{ Ç¿Ǐa`DGqr:B͑wv9xipK§wTz}~Ve\/fo5iT'*CCb {U^r +KȒ9dNbwEw㗘{۟G\Q}cqBLZ>v!8pܣ4&1鰺[B S~{4.u w{0]ѩ&TtIjR3߸wͧ\wx:\M%%82362t*;*{]jWs3*۩*Uc*\ ׫/瘝*nR%VVM/RlVgfufzŸ{^ފЬ{6Yf^1{-5{-տTՋVu~Mf]#ߩgoг7'+~^P/Xh{5k]?t+R3R3:3R٫6{`3W}>>QϘ%nNuf]Ym֙:||lTm>|1l0l= rG y@.ȵmrm\&zV&ɫ rjnz ,?ȏ r<ūVh+ß)(>o7ˇ5TjU :ʮҩ7SveWɍrxn^7^/G>*Gu6]Ml'I^gYLnQm9눍:b#շS};뀍:`ب6ꀍݮ5z:]֪bmX.V`:FlnQjӝt6ݩMwםuziԦ+JQnԪ*eβK8Jw٢lAu:faΰS jTE̩N5͜ZU|oT*Q7z^T{joSMob*߬7ͪ|gnnt*?g]橨y*5>V5;FE<]E*" r͋* Ǐ2>'y|/f,y|lMEtZ$wj:i)wӫS&O }jSCNټ[6Q jHd<[5b|=-cE.cτgPYzD/z} %z.7zetFˈvQQ2]Fc4=FSogٞ(wʸFwJSҝiFmp!wkpw˸[5[h1HAwbН3t;'i1wϸ{ݓäg-r!wܬF:n=C7L/NQ;1;}vfnMSx8K)a5i1]cˈ3dɏq(:5Ο7Z/9㝿?ߏ7RDuhtB-t?_oߠ1d o-0?N-o;;.s_4ivӎ}4i\;cq4==;wpývπ{숎sEW@@骥#)}^n}e/z}D]_vחewwmcscEwYl]K5-w_n[=4+TZZ)5yjͧ|w".[5Sp>sUDhh^Qb"-bzkfkf\rckqorH8ꛨiۈ.;nԽdĽFڛ({ʛʛʛ›ܩ›TUFc=2,^bf=VJJ{>FhP|NrrHYY:g4i ]gs#qbT|JSOgoesۢF"wC"H XM щlHdC"vз-|2wﴻ$iq;$_2_ڶ6O-[GyRm'i@xWVK}VK}VK}1=OSS۵^:2xy92בUOUOq=oucucucuc5c5c<[XV=V=V=V=Qѝwcwnw[nkcn]Ƹ7:3;YVv tp jhJbwmt8[.Z:AJuw:(AjtPF5:(A*tP Tb|[oq7q׋qj>֋gUeʪ2%,^,ŲJ2%X/֋a֏Wƿ͋.DWJ\f{ fftyv$1h])8!4|'43p&8'p.')|gq>> "&K_Wp!0_Ce4`yxBkx+VeuX>-|OZ !3Ȩa(QV٣GM8Qi?[t"ᑢ!~iቢ@!,+S||XVa^(> ķ¼o⇱bxV(Nag=%PG!FV%V%Q2$P?ŁDXVr.m/dBh}wamt t |'DB|a2b|KM\da~4 7`:nČP-eslՅk ]\܃{qxq{Oj?6%ocۅ{{amQ18C8t(.:ll*puxL<&s9ɜeE- .Q^݇CF5z[h@#a=6 K%z=au C ab}b>;4 HIav'!?7X-) ~Z/VxrX][6_ezLt܈6VLbӨFiqol.}t(C1֖%jmZ[V;Nrnq)Qa4&? 0_.Cbsy<̔3L9>MOS9>EOnra<*ϧ|jT݊6܎w.038:ph5G/H:: ~ c5xSXwxx9 KP?ǢcEcg~/bbaNlJ:vW[]v޺lui17Fz<7GPn-Ncەm 1pF܄`n-x'_}uuuQ-{@`A z:}.}.}.}.}.Q}(Q}(Q}(Q}(Q}(> Op$> Op$> Op$> Op$> Op$> Op$> Op$> Op$> Op$> Opq1ځ? i %D 2QL %D 2QL %D 2QL %D 2QL %D 2QL %D 2QL % KKKKK     /k| VU%yd1,-G9I&! Y']lnjf]Lfv'2۝hr\?D =V ˥rRn@ߟt2];&Ӕ% Y#yd9,<ӇgL3}x><ӇgL[uU 8@9`O{d$/K$/JHR4*!Eϋ>J!RH{{F)Md<2jHE2\kRxdzEBQP)E=E eRhBY3b-*#3ȃx9aP)B CyP)G ByP)COCOCOCO8jGm= u/D/D?D?XDz6 H$r[r a gMGD#H80Zx!Zx!Zx)Zx) $^^~/\4Bt.>GlE_uEE7) 90/fv> Džh q~q>zGO 4‚j+|P>G[h mÐÐÐÐ zE5M5M5ͅ5ͅ- --ͅ- -h$Z?Oh$Z?Oh$Z?Oh$Z?Oh$Z? J+J+J+J+Jyp^];=/xw4 -CK}HK}Y/u^UpX'BQF ׽^po7 ̮ۙ{u; 29σy0><`|σy0><`|σy0><`|σy0>GUF&7n+b`7rAA.s2Znן %N֓eTudWbBf׈5~iŷ^@g~K[w1 jU^dKe\LPM ?+r=br.d>%d‘+l6]ՋdV&bΕԞNrM&C}5ymZCv<kG둽6[{^f_!WmzE&aE"l18Qԛzx< cX(ƃp^-Ն7X l1APT٠:5@MP  @C4M@S 4-uh 7` !0xc$ј $9zy>{:e)=O?+$X,#숣Zc#xf,Ӷ,:Wf(׺YRZYNl\m[L\+NyE`0C00#(07Yl0/+U0 x,o{Z%`)x,Gc ց`H 6͠@/EK& p.d_1]`O3fΙ|lc3u7B.XDb,ncwKNqA 8#@eJ2jꍪ ꀺ|I]j& z^Ιzkplr~t~p;x?`(BDpdEWڠv)N ~w.ew>&`^w Oi`:O| x}^l vNŮ@kׁv`~/6hp<#`  xxL$0LO'40O3~/1 iN\.tF`8S9~NSg죟}~>G?g죟}~>G?g죟}~>G?g죟}~>G?g죟}~>G?p`秺Zf-FYѡ3С3Нkѝkѝkٺ('6F6K*р| . Gp~JRG3h&䣙|4FGS$h|4F(Fbt@:Cԙq.g)p _}>ׇ_}>ׇ_Z _-pbg0}Ki7zsr-r7Ryh]Ah) y'q@/?5Yw0墅\)ڰmåh2!cݿ9ԇlt8\+ϲd5JDAC]Lcܣ?;nqBoU7B鱘cT̢}֞;仁$j26-KiYN8dUebJ1<8(ѡ=ʥ>Gv&Z"no3{Yr~1M[f~6-׳Q9+|< ТEJu@BMV;U e8b[%Xv9ò31,;yfAp\ Q9;iQ;iQvelz]Gi3l#u“pq0QqhL+!ƸDZD*Ļ//E-II ϡ=g½|^WCۍEGmNڹгɝ%zv0ߞxfP{^.Ħ=4%O^"jD*bO{>/ C77ȬwE;AlEEk`_a_Yϔz1 lL/G%C/7;-="+þ2+þ2+þ2+g yb8FQ"+1⯈YV1+*#fJJ~^d'!o&.-і%:i=' "/RYlXq/he} 1+ U{tai|[Q+VvUJ~VO9gOX7|.ρxo?Q濼';suYVZձpV6u 8Ͻk̽\7^s XV#nCx&ª#}է(oJy3釧FSQ#)*vePR*5wg}3Ϥ.!Ɣ7N3ʚs"Urz)`U [kHE/AfhZMה{'[7Tr&f.uxu^0/7~C7~Sʚq9[0?fN95zlȰ:ۭuP!iBiNd9yQƎvx6iG!bS2{u>i}z2%VZ'`-o~?LToY~BDE;“{# sC0&K3{݈8ujL Q YI}zZZ"j7Q]Zk+)!]a2i"SZCZK+;SʊŊΊn亖+U*YfV}P!u\7^S5^sk(7͕+Y.vaMa+U [hE&4n8vG"70g_;_Z ~iCXՂL2C < ~n;gPg !ZIuV\/7(.wC<&īnX,C^z1E$y=' P'ϋBz|ŨckYbh-vm.Y5]oj%FolӼjcUxxըg|h2g-͖fqG3ϸȼҼ'Zbڸlg^o`䙝NUfW'yqi\k2&Qq9ќf6gOsx\oL7%sXhw̃=Yf,3GҔX.+d%YBfl+#ke#X/fFR)+yQ ϖg_syVy.[%RP^&/3FZkv[E6ߊ"ENSzlI~VkUuinupNsΰnv~muvwη89-%֭eeVwO5VqZw8;;>Nw׹o t9ì!Hgusu3ywF9}gu3ɷp^r^:y8g3ts; Q51J&EeMkMzhh-kVN5;0zٽhvsYo=֛n/k{{ksYC!"w;ZpG[K1kg.w-.=mebMb" cSb/D&މ-̌)fޙwGwώzAv%ow] {#o7nM&-)i4yLEEo}}ľ{{߾n}}f;{뽤}򾶻yۼ_oWn2qaq~ nmۏ+s55xxs{f|t|\9iSxF Yw̬,{iVլYu٫dӅ ]^:qh(KzޡwstNY#J8ӝhE:!^{Obo?kpJ0BN0OQq;8;~h㷳9Ř__vf[s6?^USzWZ}T_#g~n0}gwrr=GxgO]:E[K9k^?㿪_39zsV.ă>Cz?l]/~f):UlBEO_~C kI߯D}~Mh/w~$<{G[a<OFWX98/N_Uh]a}C9>t~Ϳ=/G6m;mNՀ?rnq׿h)W.^rt &~`[=xѰ|jxP/Ӊ D7(+ 7,q,M'y*E7W`VtVvУ}3"oׅd'WLѺh-&[Q^Dw< nmE~WN|cMgFeS r^\(6]ZQh&,Z^ TǼ#Ǔb!FEfcͽbl8<"321!bbdyLL d1Cvd7yȷޱbfj~~[|io/+Mfm-N 4HT;Qh:5&5tb{DQD:tboı@Ӊ n!Ps [MU3hJ3*ΨfF@Mg4G4Bi#qxNqSũfp;5NmqSihq8͌~ΥN1v1u6ָu6/cx&2FƆ&JǘUjK׼׌y;Ɗ@kkal 9ׁ0Zh cO50Z8h ,Fy#0ͬhVTYճjnѬf6cc1PtM^JOvO6]>^^USw1UoaWb;{l>HoDT'D3#Y/HzzG>eU@[-M0EMsZ7: z诵CfjSj/ZwDu|Wqd?~Y4-nߊO}>] kKnPV勘UbVdE,F ^B﯇Qd<'b uԕJURJJVڰOOm;vK4-W7g3D#Y"*.hJ v]Q@@5Pj(Czc 5j$G3S3V=ʸxNT)&jLj%t,fPn?gIsRgMyj%}]:,Po2oEعX-fM%X\OZj'MkPmU;XhbVrESUJq:͇!jV[J)?`Qu\\j:V:}U'"фw Dމ&Mx'N4h;DD1u 3) b0"'Dv d(ك J( dVbXT `0V3O'D0VDUbù+]QEvE])lAƾBy_q^dwQ8X($p} ^0ڲ?\].du1"]yd0TmU[J&zoP8+n9at>kf6 %%4H#Q4Tq5WU]Uy)lTeRQUUVWUqݖ^uUUO]WUUEUkꢪnVRm9ϞyݙysfXɻ9f3(a t*y:kӍ0Qx:|j.3A*OEƙG{:NSU`[YGY˘::Xn-g!V/|Suu,, f!?%L yq"kµ,K8yHxȟ~ba)qsR&$obfG"ȏDƒD =H][[#[)Z#|G8:;";^A^E(?^#Ĕkwxq}uW۶+\y_UI9}'Ţ;JP+:W ofD_/{_T0"폮L~g|O#V:iVc{~]t=_+KMu~֕W/W GZvS9ZKrWZ~s6c TιD{,` z-o|%7k^CWUs/1Vƫ*~gu?"nBތI>. :Fm>ߡWɓEkk1|l|4VoZSGzȿP,\x_7AkؖUG\/^ =bgyԪc`UcX>_cJYc ߒ^aQ>G=-x۾416}Il,6<.$sT::t*¹w"%v7w]j?zs%ڬz3ײF<5a~Tge]U첟J?'1?>Ο2r湐Cn1scVۂo}s5ʍ9FrkpV1x|3[铭0=fcͯD[l5#Yj~f?p6( ^f;Xȍxc7^8_w!?_XwP_1 qpb:8wڟU ?Q>6cXDzWnvq&%ƭc#7З?6|? oZͽ7s3݄6ѻo/i,nW8'a)#?ޏ.soaSW+~\~6s'F)6}}~eg+uվ ҊEȲ^RUY~{~*~Vb~}7,pEO {sTjV ׯUڬ ^QUڍ|cE9@35Ohsx׾N!c Jl{7k^黆.%MJtՊ Z{~`%u5/Qzʟt0p!YռgfVi: k?ҫ| [hp5fn@-m31_jUٿ+W_Źލ xf  8 _3N7ql72>u9{FۻѽF1xG9C(?ߘkq[[Xfc, |}LkΣdߏ8 {p]@5?U=_dXML;૯?]{cםz֩KǪ]u*$\Sw|#س 7Xǿi6i =8_08g?jx$R!d 0<W Ά15spF9RWqxXo좻%{s@ښ%ٚJ]ƥ1F ոo Y 4=?#i)WÌfebILfNǶwwm\}.#d_nGel8U|XWqZ\&˾c߉+U옸V}/~,~~%nb'g씸UΈ'Il.Es\a0HaNI3)̩*"IiTBIU.T"HO4@zPIv>VNoB W}LV ꛐǕބқ0XCH9Zx .y0 cޛP >&Lo&5ބWƛ0k ƛk ƛx6+)/(pu7Df&leu&nb#&u%WtnbrHVnbg&+9\M,nb>NUQEfѧ!85L W#HBR jc8QmƉOr5)&Nk3j,]q59&vR;/r5%&k+\wM|뮉sq.]PGs5 &.kBIIq:Y,>Ns5q W_k{\}M|_}[]%TW[v qGݭߨ?G*xgT"?qU6Wel`J6&յYHKkKВbInX[:HM-Y.R%ے-%ZYKYzXzJɖ?XR,XK,N[jombm&eru73WwjmR&ZTڤ\Mz2oH?'ڤjf-Luڤϵq&:m&i3NuL!\T봙q6ScfjuLyBS"i3r6Si3uLN3i3uL9\Gf*Mʚi WY3=ULy\e4q5SQZhЈH(fz:IcaD^/_ g?E`6(2fZ`TY"yH{PaPՁ|-b+ s(_6bX3ѳ6 VcтMe1pC!>6$ ,Yh)Dhm#w%h!)/\x hIxϰ4ak/LnC^ y6䵓@~|w2| X#)l7"o.›+ɧɧGO|ɧ7O".Bo^>|y&+_Kno~,Xkd'@޿k%EKѬ#Űl> L D-,!e;H7Kv:  XwӳLu7^3=SYYtvE Vi0jz501Ea1Qe)\Myeyi|^ᬳ\Gم`v$ssD.oga$d2f]wòG^y/S}>VO/g!|Nb6>'a0##"03}z<&ՕY>WY|J>Ųi|I Yf__yEduI1L gf,beaJ$ES4RBP,Ru#zD|ҐE(h9Ve\)0NC *|37WPҒ5PZ)`of&%QIdmJڿ]udFi2)J U2ϸ諽t%%;(B҉Jg+JvS1rr7|G|>h!Łs< F;Ca2\)f2=>d]xLhe4F;FYUƢq88 Q+KR2  5 %=2ӵ1 23ȿ6giUUBf-9se `Xk/_X6_{Y-޷Dm{֖brJ{O[wְ?(󡶎kizm=z٨} fm F۵/(S {winm{,,y?Z*Y ΕY,8mSO2le fK fBG`Cpޯo@1bQI ݈ӛGF^Tpz3y3hb݈GS&vލxxyn{$0rxqn|w#ff݉[ nAܺqĭ"nM9ZL|Zyl b̙te:1#Y\9MI\!q,e<~!XrCb?R*KQ4b%/GWN'SY>T>DyΕӈ%7$N,9Xr,9XrgbiĒ%w"ܕXr;e{9?3vQ8,? ~|r^9ʙq&1,0sN܉8qgsSssօq61E<3gnhnon +1l;&W #-1HE,TdRXoRIEL61A\KL&-0RI*buIE,TbHE,TdRIEL&0R[ME,TĬ"F*b1"&XTdR #1TꒊX ɤ"F*b1TdR #RI?L&~H?L&ja2釅~Laa&~Laa&~=֓~H?7Ka9Ca2$ޤSM?L&eXtQ[-$ ,]MToC&&45Em˺R@dh0]njOKV{v꽈d"3Tjx<+1'N!NZNZZ`)W<ɠئ!)7QNQyӕL^4pWWaE<ɦh uj'K7yK] |OGoiN?2"$55\m.G&@dɛM[Ē)2iCI[LR RvL[i۵OU*]$bTIhOw vնj[Q$ڗNؿBL1nI,E&>mI 'k_kxHz#QXR`vL;< '8 L$8 Hc__\;0Q340@RlbH:6i, 6&mX'MD&me mumua* 2x-\k0Ik0lqIq0 m)EbH ǃ &"jNW[ z,m/#ϕ I1)&ra)Ɠr O4j$1$`HnQW:xIHS#D:"H+V#Cڈi&6PbDfA:t c"?˼&M $^'#cH=:s17@=*vQ\!_acvYIAҐ"be6,7i{usVT@ &>dcu Y)6DZ,ϼ i%H!Dڇt0zkUHg;T<)>R ˋCJWql lyIߺ)f{:b))k wB8/ׅ׼>HMu+Q1*pRqpjqpzq,pfq3Vy-@޼Arʷ:Zԯ|cQqaf0K.;tЉ啎+)+?X]ܛ/pQ~cbpG`y-8EcnQz1nFt*DKREfWތZk\U-yzrW a<{;-r'4.wr%"߭h;͕Bpurezr](?Pu콊V]}sҕ]5Tn_^mT$̯wy0mzM._&}E;.N \W6 lpK,y=e Ve+|vW>aYtPȑee+ yT}0[1>訮>P-D JPGƔ6);/;* ?.L,;L);L/+fا8MŽk,Ns,@O#`?Op'I:U1ɨX`^/餏v8mfאָO-x}^TnXMg#}}3NY8'=q^,˝ iA O!p \\\Xpg7Ͼʙ^|jmQ2pGnXo_L՗n&_M }ENϛ Vϳb} ygy0Գ x³xƳx޳Y_=zvy݊}n:.g/}pO寰簾^ovw k9Fx2w؏9{%fAL{'ܝɄӀ(5x5 x5xƵx޵X?ky\˼gsyVJ`8a}F5q׻ɡ8Gk=Gϋsm:4\^k_\ Q`' p(Duuا_bXoh ‚pNG3ȼ’㼑f% ȻJ#KRcJ2+ĒnރVΗ1ySJz/q$;g[8z\{‘朏K|Źc_R|pI [^2'ݝ˽yJ ڒ %SKn/yd6d|7}&ʛ-Y\ ܀q+Y<ɑ,})ygKVDn!l-YWJ6۽Zfo:;p8wceU>?000$YY`+7&|v^c1y؛~o<<XoCwnK8 p'qNN?7%wgwGgp_}?W3/#{ _zZtp/8_|g~zqցǘ}}'yS|W=sܯ{sh98,uه{2FGÇu6:6Op/WqfX9[9?dsFI& 1ht}7 򷸗 wW\{ܫ}#ו?X^ܽ7ev)߸soJ>{ }ޥ T\Sf FJc|oړJ%))~Q^[Uбcf(|k K} zBiN^Sڏp ƶ``io{A^P߮N_etpRX;紹b8?"R+ J`B4`q8W ,V:o,+Q`R0tX`/i7.+?Yt?ss,](;[M8L0 0aC!cYb ClZ%Q]J@w0K\1>11q98g 3Vu"q{>jnݺ?{Uw> >NrTwzox>/zoy-;zC`=sǠoA뚼%ew<}yv_!}O.zšJ\W-}jl*tyk_ mL\Y:} freYt+m)VY@n{)w]a䎽qF'1[dZ!:/$}QpjYR=l] ^V (cjw"I@* 9 z8kU5!jC˃rFp%QޭOt8 'U(qE!#b)KO|-.Xϊs Zd|>O dپ>FI[ѱR lg&lԷxX>Y7|yE- 4;z٣2 +I"U >yJ)eGУJRFev\)`' pL*Uj_M8N>L vJ <|U RCaƞFvAi(fQ{v1_&62KJgO=uif)rh){D!Y-Qnt`5Ċn6dX:@,K<G\x@@<=áLXOBXx{4E=9:!^鞈׺'c[řX:xZlh\=37bĻ݋۽WWc5Q䜄-Ƙ M1̌)Rv0'ERW:dM!Kc*O*3IǠRU(#\eTt\r9R)W#[Fe:R5+s\Op;}-#D;ʭL]i:.kr+"Sy0OF\ tDd>TYHG?+2Fq#G0gF};/GǝWGq[#ԘG.p%%r]w5r~:rs~!2"׹[~%r*=u[u5~{̍IDV%jעi|&4(ɵl3oߎ~%ZG+yao 6~Wm;iQ O2@ h]" |0P @yTF`&ۢ$ho4ğQL5:sktH;BR %g :: 3 XaàFG?0::nGѾ!02 {F`":iL${^`*:e/ Fg%輽9Wc ,D5\E)Ztn <ꝱEW8fomYkvzݙGvvw>]ڝh}Fkn}iڗiݗc]/>q_Wo}>{ pg).ʾFmi︤};#8ۉڱ5Tw?<(~Gw=s\ngϜ{CUcN>[TW{x{[NR!Q!={ M:zA. K׽^ҽB/rtoWtѫb'k较^OiHyeoeɳɋr7tOQ }̔ojBfS;7C_3}` L+5tZHOz^AEuFB?AEC(]CHmFJ^B^^( dMRSmGRv*FP!:L}*ߨQ_K~)E/}_߫SoQA^E鿫k*՟?u@O! ~Vs-w5u\[?QEGWS#MBj2귆/<d &Ю3au|Sou7 ])]#rBb5+iôm1O2a+((^3ux[+ŇK)Mʐ BD\ʥJF&5HUj+IG H!)* HCҰtT:A0"JcҸ4!MJSҬ4,҂(-I Y9tcG>-zJEPQᨒQs4Vc"`w*@-N;hsW-Jq a{49 .<70"a2BUnמYp[Gnh7+0H %)- .@q@I~yR=! awTx*= ~7yO3xVgi InY/J熀ko"<CgxsŨ'<z ρ<y2w89LڻYo5}s n.z럪S~^89+]wFPy΋㞋`sY\}SdHsގ8'sq+wK'8WH摄$k|^ctJWIn~}נC:!qupJg8su7(=~;c>Hqdyc~uzOatx8p py/`n'}{wl^{ű{ Qc0{cuxo:vyo;:ww!x;\އEFx|I c cB# GgG?3(p!9qDq'k(Q'S Fq9픜gRs?=Hȅj8^} f5.xE1<'m]%8.C8jK!D1Sɱ8W q=AǹK*p%x].wܔ+ymqWXe 9}G؟V'09 E4^$`s7i>B x g|k_%%~3Cf;e)q?.̓=B9,Cr9J8ଔ5Gksq%L<LJ=C٠-O ddN\_1pzͮsm|2Cg9g}&z<q]Sn:1;\3mS9G%gH]i8sMehm9!?rzOs#vHN%fZDrxB̗].F=p]8sgKp'?0^OoB%98<))h>Kbq9DGf8Jοpϻr,Vr/.3l+|4c9YSG09=(kg@#\9ȓ!ygGyds0G8GEbc3y 9.=b?ļ5ӑAy_s?A|5K"窯Թ'_"}v>Uu|n.S+e5ver|;}혋|]>8 rZߞ:_/F_Y v5tj;NuB;ǩk<.]:໊s@qn::#puw{I߭Ӿ;κ SĔ2LS۪gFN^S`:~ ddfĘA0s9ɜfζ2癋Uf1ir`djr,3cVnf,6-`2v [ne]\mawQfB"\_σ'}NmAA_%},#$ }~зnd7~솾CvCn'nh $ -Beh3d7~~V__ϣRMD JDHDDQy쉾KDɞɞh}6=dOLzП=''U<ϨQ?BmdOkdOdO}[JN ~=X]cI =Uvvvv׶r@t6G%CHa(}G%t9]IFtmJV,ntf7bt0G`[W`[1[IKyl6Ebid%!l'l`dF, X0Wn~X7Ȭ=7aP|*-2d^&3ZHOYɌ3BŔ3ZBv?IY,%)2edO QJcM|_zk+Uƅ.hm1[͢ }jk™uB@ ,$9J6O\ӶB%5l!Mm"glM \VMF׋}>fDž]Mh2^㶩Ypf0[lky,|1m"lI0Yے*I۪m>zYOA%BbTeJO&:3!stOF".-:. ;t:Yܣ+TBPRb=l Q0;vLr0HWG;Ž/3Ȏ$\)]m)vJσ,8@K2WX %vDׁkp^fq:v3rl."Z*sU\-W5radɜs;b*NsҵXUp{NKs1l;A0w-Nږ4ϝ{tq繋NPϾj40ÄeH F`L1sB-6ykr|`30ZBP*T#BP c Έ}> 3BԅX0) X05+4چfۨ6I8gUh_c\i` Z ԘLc'UgB[TN8 $O' mK1fWcIpѹvwKE.\-.+C+L[ Y :i= r,y֋m Ͽ?o 2m&@ns@}VvXAYVgv3ɊeRHΫ'kMdc 9o*Y*ry\Hk"9$M'kWjUDN'ޡu f8VñEJ)kg>T4hfT4p|hM 5Uނzl< 8WEi8>h4\z i{@plP/F:T>,0}TXxhm {s!rW=6݂, > { }! Àpb?c 0S0|hy+ rω%| ǵv==A eҵc <+ >ۋeOߘ9߻p֎[7nχP*UilOdclo>q;IWmc+il;nSS9 ÚolzM8lq*Z|On?8ƀ5~v8?oq:1_: p0ہm6lWO|/v;i3R/iZӺ9JĔ<ќ͜tC/6i$Xg6cXIº8g}:Xx,yveh>addcf8~W qQB8/b`#~ \[*/ |<byXmbǠp G>Femހ׌O\Q|4dH$>$e2U`Dm|fGvl~c49݁m+Y{<^ZNA251zԷk;ہ3ΗZnϛnm\u >hlt5a}w%XV1Y[)3~e&r,3|ڵyIy\fM?|^i |ɤ"ߚ2UhQh<TBA\v}' 55'kک[Nƞ8V M{~j`M.j: 5\Ii5a,MU;ű2*`Z9 utGe|Ďj?*p}$΀m[q@jUR#GKvLc-Z0@>f<y) Ex oqiGE Bȁ,#,Os7, Y kk|rF;誊odBcy4(2D26B|LF`#25McPIY@ " Mn^__[bՏ]TUԹ~H\=JۍMocTVq6KvDޣ>R*K]꒢K+]]'u@]2JLe.3uۺ,e.+t Ǻץ@me.u9K.k^}M[ARqǕӥRз+z qUtI%uuilck#t%je֥.p]tgMe.ٺe. uYJ]7%{YnG.g'.E0?/MWQ`{)vj߻|]*wUwUӥ(5y.2y'(<YY<37rH999.r#r'jGh|47RtiMv>ɍNNΌΎ]]]͋~{} -;/z8z2Z=i*UIKLKN8EZG:E^3zK6<-+m\Ĵi9icY,me$3-?FOgK=Z>9vrFNW>Bze}OqA/.* a~qP_\ Up3U#Ld8rVIeMOC l9m~8rK<ͩM!a7R5lLfo2M\`6:v{NsW==<֜$6 cO?m%tb9uLd:9w-x]EvC3=,Wٺf{LبB+ e7{,rWQ2#://h˨g-ߒ}ocz{4ϸ:Q?FIOLe~} ݾ2GelX, Ujaf@b< mU,S1h&Yf]d0fb(ݰH+e+Y.wV)j *rOW\AbZ_qOL?!5yRּ(Ovu*2k YkN3N5x~xߐD^SFùEWuc_L;0ᴺO%b)KF1MZ|dxH?{ޑ Ffsۯ-#}2L=r<։FS4E#+2, Gٙ3)Ong3ɖE)y0jo^=9[ə]^ݪ<ޖA_A^p=̃ʸ^X"jVn@g'_ob0 2JS^,?`}:*ώڊx!fفu^VN|rzuH5@^/_}•,, qq;&z txS ݪ?I\S\=tg1"k0fS-7; m?±B7'X9_J7Y٢n@E\ȝ?Ij Wvym%?"7̾[3ќ7ɇ|oݳZXqiͺ"PW3~9=kuʞQjC],դMp&(T#5@iWџC}_}Uk"wp\+up^=nYr+Y[:{g>j\T^|~XZX̎!`v{Hc[ܭm_HٯZ^O;54 tnjkfg6O9K 9#;Uv̩8ɯDwɖjދ8Z #9{]}pǎ(FΕkqŁRNp"\4oʩm@?;HlllF%|VsʍnU/ 9M?J&taM=> 'e*vNY+gOlf:c.YD7?ɹ9|UNN3.rZw>d,wKOHuz;؟f–UjyTa=S7Lj̚^M{DSLlodN(9N:9rҵ$=Xy3EÈ!"x Ŝmqvm8֚ݻrVҙaXUxlF<TY>ή#dt]}*t5W( i1#-XOgw&Y @ġ%V9ET}n5-*w+yksixvT|-oD4Zroаߺ5oBg'tkUg7[ºD8Rv.@\:ŹooG Z"ˎCDoqd8f\&7Z1Exh͇~yN&0 ]9/sV!WBi؈V0٬"m2 ͱ|Y~Cd[4pe6u`g>9*zmybI}RNٗȫlR>r=-O@6sЛW-~hݣLވ638-T%hR:CÕ,u49BFU 4W\D>YXE$z-jKh =4^ˆu#]jy06k!{HD̬xD" mG8X谊nd-C-iDYbhݡ>K`DqD)&yed#~ MD%}1~n"w0٬YlvςAMnl֚ yD67[>S8}}8.=| Xp8 {@{G_ClĿ́ad?>aʐ7۴=` HZWtt"` ! W`kI"o"z.!~*޸X;zh;ձ,$[GF6*Qk0N 6pbSDnM[ז]ġ0\jWL⾓I KIh۝w%OMc|FҊn|/wgOPYp9s"_^V:{*ycבy7N}yGy.vl:ܕJ/iKuJh UW; 6v'C{x#~OZe|?sdƝW%bvٞ":YiiK[h%Vh +B= rM~:[{Cmo7 i8 q}N}]>I-4>SEVA4Pۋ[콶IUSGWY ,oNVk`4uBsAO7%mз (#ro%JmVqlKȯ ۶-k 1+jnl$o]-uץd]lϴgjNm[!tF`3滎\& 7tǏXD۷uRo\}e[]~VQnYJ=+zeϴSYk cCD>$k%Wڲ%o85w,*{TU{ /^?BQh r!\ 7Muy.ltSsBs܏'~wo x#WB}}`GxE\^w DSg1,({cy zw0T j4\ );ipТv;jD.?>690ȟ  OgDN)m5<\1zh=Qd1.m"ѶHx yp'!k2m1x ^>?vr.a!r{,Muaa܇6^`x5u]"ԲFô͵3Ϭ;bx֝ϧ4?Z20eVb-{ K Z]wdsFLB{4q-‡a@nx~&~սXd"o?+8 sſB!:W|:WiA׬nVw7ʐ!+fbWÞXEoFdg?]ȧ:yvk"<̈ )"4f޷π >;~6>M kȚr i*YDx=s/z(]%lvuw(܄} 931Ud/XGkhYL[3̻L d9s!'#+<_cuwأqRrqOйW m.6 cXևQj"<,an%h!S`w4xEov~\D|lr`;?A>FψRo{kyxȌW|y;9 /#Ӫ{߇y11ـ2\ Ѷm˰ymjA_M h9M]ҖQ[Sˈ2<eLf͸&ؽ0>G9p=f;@ZQw/t邇`!?zq%sX٬,w{acWht3# ts qs n@f]h*C֔<:xg=aO[w,7 .\LppQ!6_0gƧ~ Y.os2^62kǝgNEv 7aCVf')F63l:'Cg 9̅^h\{#uwB}B[}yњg9oQDm$Os.OsD/_P-DWї6ڋB4PoƒfVBΆKx4[Tޟ}H{{>  c99 %474gbroMeZ5=jHmmjCmB>>o_7}:a@xce7t&AFUN80y r.WfAϥ'l@SgAFt6fJl3v%&o<*O9mWùx㍇}MOqj}4fLE6Dcg&B3bH~ڣR.S-_4z};),r2nZr i'w$pP?M $bsy^`vrxJKl )%Y'6veUVհ?/ h<$ډ\,f21y7IsŞ{`:WI4:!KVMo`sg?J4:9hN-M{, |e_O[0cxGQ"ZQ~d5ѐX-IaVŴچeloZ23^d?YMmfƥ̊ֈxՆ+W{\eofڏZoz|^y:o`jzhI6YGinl?7{#$z_^!\GmxO9;2_d.7)G~'{·ͬɊ;|{\C>a.DEܦwhd i[sc)fv !(]ƹ`=N}'ya(;LOن,mJ ًr,#XvE_AϏ"; X}\[Pvʐʜ1ds_i% ˌSд!2Fsgp2W˦MSo!7ס'O"C~?DŽq!d~'.gм8xx͐!7/"WҪ}NŌj雿MP[UI#y66ߡ_|P~CV9;eM>I5+O޵ԖJ$&6&AZYv,i[ʨK#矑"SKF@s? Yq3љ*7P2(}{"C'2u|~*AZ=RSYzUMUz=BQMTKQQU?} 5QM;pƩlMX=~êޝVP^SCzY([]UjiIj`όHZf/\G{lڪT産꫞jL5ZWhsJR(ZuT骁-j}*A~Vꤺ3jwCKMV3oH5Ff=*U UO{hګΪSԓjQj e:(e I88iЀ̱L8.+jaЀ1Cmp7ÓhРYyX"tmX ւ a 0cFa?8Yp8tA48<nю>xHW5x Ƅ LZrWևMaKv]_?'Ca&p%Yp.|.a.\=Fϑnn)x^Ű3rP`9k0e̘#ž/g±p"gyEṗkaܮ 4</yi;xlc^ 0 Jbi{wg]6ɒEXIDIDA Kq(1A$ EQA2H_ML~?ٮI=<3;SD򒒗Mg$MɫJ^Sz7.}58 :R š{nsİ9j2Q/k8;N 9z_?ùQ|T&=>?*p7yəjxM{p2\3Se?Y!%TOقPOPOXd&1AfϣPj#YL98c!,59vt#p*)ezL Sc՛jBmV? IV~Lc| 賺az,Y_Se ^Swe{S2Og2?Uzd>~B|z,R7K=? 3׳RoH=9bT]NAqm#i3+W&Au!)v9b.f={-[|6C5 eM#Y5j9ï YF|'kFqU1*QM`TWۻQ_H !紘3>ja⿢jW1c'{ v! aó8 8xx+x/kHR!<*Uvƨ\*UUAb0^%0Aް@U}a!G`꧞jK`5j,WWa6J^.e]]ׄ+JOP[khXN& ].X~~Svok 4sQgxًjG{HHWu2?2\] Ea_GSA*c0FQR1*TJ*CetvJQ9HsRUҹ Uѹ*Uy6MT]@5GuOm.RXQY]CHC(޺8=Jԟ=K K09zN .K/&A#t9EtyMu*fOuHuELu%BSteJSuN-4f&oY4KFiF{:}@!}k\k'MҧvZ@ tZDt]ZBKt=ZFt}ZA+tZE%}WnD71}K&=}ڠ&ڤ-EE;hnAGnI蘾N ݊N)}^m%~D. xV<̖,$יQI* ª*Q* ͵; bw;ٝm{AnC6b)8*@/D PNE(T$TJC%S&M<䡛fK"@2[Oҭ[Po!nԚZCjOFJ4(Jn Ӄ JR:C)C}4=B@zdzH, p Pp(OJ/Kp3B@I#"JB%Cc2q'&$Jkp+Nm4A5A3:Ao@ zނ6 ]zj>Nshԡ#KP4wĿ;B#ˡ1لh۔VsmF_smNk8IqqmA3ZF挻i3sF+NyGtBk:Nǡ p21B('-k^i\k.Х%3c?$}}]B[cPC+,VK :ԃЊ ]Y?r ca QO4޼@QzFlbF eۇ&6=YؾQ/۽(6=%^'}kp;j}@dxpԨWdFȌ  3.@d|ȄI"D^  zȴ"3Df VȬDf 28j 2Uyo"^" 0@dnA_$@f^̧2Y yȢ"KD, Y 2@dU"_+|$=e o"U" 6@dmȺDl 9@dKWl  #@"D  ?@d QzʮD9 r4@X"'DN 9 r.@|D.\ʕ d@ dd"? " ~O蟷̦bFú=T9һW}PIq}BԧH%\k&tCҝu^uN(Ga%~\~<~"zqz ##e! +uo ZVF3>2Wrs%uO5nW(lQҟx XVQp/w+JrZIx_WA!b8˶BVXYh+,?ngUTHL=Kez^WU ^lg׬o1޳5QFn .}ѧVoySBH/Krz:}?g ~G/ =uv%Tsi C`(_p "W+0F(xFxaL8SaL0x̂a6{>9!|sccŧ̇9,E9RXaUG| ZXzaǘ-v?N8a}A?0(N)8 g,p.p .ƨjTw[R{UkFݧWmU;^uPi:.z@uSՃRFImV[VMmW;jڥv=jڧQRc:NS:Ϊs꼺.%uY]?mmFunfW붺~Hԃ3z~E=?֟7zVu{^o&Yo[6]?VeVk`m6Y-Vka`vY=^k:`~Y#OQu:aNY3Yu޺`]~.Y+vĎ5LuS4Lmsczi`0 M#41MM3i2-LKsie1֦oښv=4N8u1]n4=LOe6馷cG̣1N~ j>1̧33,0fYlfYnVf|iV|k3k:Yo6flfnvN6{^7A9d#'s3 sΜ7Ed.+affyüiNS9c:8:9rw9O8'@g/q}}>tqCܡ0Yw;w'Id5w;՝Nwg377ݷܷ;{Csw].qW7[;w]ntwݽ~{=wO{=^p/?+x)O{g{!o{ޏ!w;{')w;{%w%X;H8q"nċD"DEb#qHB${$G$13!/?R R0R(R8R$2.2>2!212)29ZdJȴȌL,s2_MRAe5]{}Jt}l6ݦ{Ʞ)ء_/n=Z={ o: uPV%Wc;l1"seC;CI6'o? v)Ls>W9U9UVf|tfP9!+ 8:O@*)͒&Cnw7+9|¬'!/+wMrw _87OJH#RrKr_Dqm9 7ӚhY#keZ(krʚ$Y [-ۮTYUjڠU]U,H5yyB\g.sffa}Xt4Ϳ|Ŝ@ج 3“-#}vƴ?Ȋ 0ʀײklxG3_ˊX}#Cy1+ȪnVEsLbq{]S/ܩgM/zq^erx^N/xy|^~W+x7zEb^-ECbY]]tW . o`nq;~cN9[V[^DII3qw&aQ =ӠvNpv.PP{cPǑPh7NROQI_=Cj0c9& +pas'B,7Ɔ&`ФЛX&4+4+> -ǚ5xgh}h= m mBB;kK`I5cspp\N pj8W++*~-|~õõpp]: 775mU~/׆(&7;iNgtu1ώ̳isxU=ʸT[oK<d<£rǥ5v |tJ G4x4N~>U4~m~PϵmlJ` 54]Ǽogr8ZY m$;covA].bhvI].c')vY&\{\p#n͸6܎;܉p7G y?,4ۂfZ5Svk״H-͡e nWSTJm]RggO~9J_g!8!K-q($qH K8Hr%yHPġC$KJ8CŋO߻X>Xb%)];=k8q:c\K \leOx /p)OŪDWRT,e,JmXQl$>,~"-"Voہ<ߦa5.X[l7fTFb9|k}d'k-] žoCS$vA8Zplbc}%N(q$fW\+y+f{_;p<`/)ߏe9o7qYGo9͜wXX/(=.a={adžA ϵan{5iq>?z} O3 aί@o~·B1e<8 0Ts3հ0_yI~x2J2cH$CNlwcK ;;-}Ze 5Dc}.eu3љLv^s8;S9.r;K2gYIgI&l s޹\t~v.9+.=%ew;vǸsݏOyg|wnwpw{}G{=/EyzȋJx%R^ixer^y/ջ٫U*y*-^UV6WݫjG"8st.P.M="2٬3uUݘyD~<$hk6~bCޅ\H ecUXlwB1jfsw%5x { !Ppwc&M w7S.-w{1턩 S?I OiѿւvA(1Vp%8Kyh#?[zVnjG&=hiᐴ'I{FK{H{fL.C3Q3g[k5gO7+ֿ楟S~`_ώfDV%W/WD 'ғp(l*ʥ bN;]v_O0HŨ2B(*P%BU6N5ԑ:SwAQoKRzF 2Q4xHi M4ޤY4ޣCKЧZF+h}I_7-im-1:A?OK1;qt9?L9_5'2S532Wc[Tc%92Ux βF/*5xY#DݥVzrӺ^c](S&׵ɿGvT#KA˔6wӮM˿I9})1JSI;dI8u7{9sbʜrfI2#37o&3Va*嗷oB/(L0?`!,wK{6F%Gf?jX.{xGry{"~G7qo`3\>3/rg+R9[lTW[E{1*Vs9Aer̫[r#7Usl1.WŹ\BrIU/rigj<' \oq{lNko6omױ鶻pU`\~c=gx92"UHQݢXEuy3£[E\^YTЬ&r.?2 A (R AP4A AP4A (Ed%DPAQ"(JE(%DPAQ"(JE(%DPAQ"(JE(%DPAQ"(JE(%DPAQ"(JE(%DPAQ"(JE(%DPAQ"(JE(%DPAQ"(JE(%DPAQ"(JE(%DPAQ"(J\}[H>zݛ< _PTgɑg6W_9M}Sw6KKWqNw`$ęixCJ'..{xG|5z٣W.G:.ͻtO+,mר7G$|rjr%ЊVrfd_Yw4j4ռҳsZ|5WYJ7W]Tr)5JJ)W6pr r_ףfiti< \ѩx ¬2 %6ҝ鑫ߝe۽c woۻ=;γaیG:z=M\zz3G]2o9q%^Zv=6^vs?xH+N^Yeئ ]>i33,wMwc5:<>ɚ%DȖR}LQLd׬CB%ByF˝w~\u]zp,W-]k-gyNH"ÞrVݪN޵{vTa2|VC}]l屢:LYSWLm^9rw[0_&1p-*6blOl . ͋(GM)' {L`z,7N|!8'qlVt']ޮ/ktU@%K)K!Dv?)$d,=NVn.BNBn^VhOx/Ae n`HH+L|8 (o7 lٛ(qa½QkwvG YT޼ր-_Zm߾c)ɼF4EVlH_UOCGthD"dIfE4p.-Aeض޶c)Z *g :.D􁾕4rNoRf`&7̂bM%[lm>'F-p YAy >fv}3װ'us &a-O +%YM?`!)8~5}6+䜧Tgؙ}a)I,wX܊57H&$Gҁpmv m -Q@B!M),DgZ G+ܒxV݀qrh^Qb){|~ͯێySnENa1¶dJ(HFE#+a#Y`5Q"Դa㒌.X-sPMcBխ,S1ޝƛuDRXYc%꫼oOw\?eQ+ u^ -D,(>YLI2 };U[+;DIPN'DSfgNꤙDO%lӇmY ޕE\ccR`E\iĞˢ' m̏^2os dg;9{H-@ dT`0r~ B!dSceyfAwO$MԄ$ߖ`x@Fymz HcUM0[)-B6T%7n~rn;Yk]ZO0umEĞr?h)rt@AT.A`gnFRKY'v=0]-˓3j TBGo/:WC{](9$,K [:TOvīO* yxUA54N*{#$zď>e4 Ճ59!Zhłz۳F|+f.?^ob爙\^ w[[6O5jMvZb+|Ғt9Nts[EE@qY%ĥݞQ,$!$s3\9@sA\%ַl[ci*8:.]Q|vBJ<4!3&J_Čwyy7#Sy cG>s 撅HRGIA: /%HtB*4U%@!K>tw{R@~$2Ṡ$>(^,.q68u[tM\qRȵPe}k$bHl=姙~XZ܃B7UjSsvL38t槳!4w#ޜ>[HCJ\եoBXEjSu8aMW7nfwǨGy$ƼqdYgЮcޝsc&G{}X!{XaםGmԔ6)rhIl?^b=[77Ѵ]f6WD<*9s5=3 {OS75\(~|}M Y,rHb!'hʥ찛(Qckn=co L,&݆ȖLoN޹XOddc.^&X&!q9dޞQ.Nׄ 5B/M%qhJhNcGas/# O,Y] U̱P )E!KZ-J\R|Y})Bă-ً|DV-pE_en/}+۹|bT9 dԛ-N͒1Fu.}}J< zx{ɦ内0"uJprXk'zʚ˳Y&N-g$J{9x_)ꔅ* hiOl;FGW+IؓlCWkt\o)*&M?' <T@DG织 $Q5㜊OJFtMH^˶SﬧUpoBZȾ.nF KzYr&o`4kf[Yu}U\S'h1%8#6gW.hBrTmMZNu6f%)R#pzߕISH!mS:cwcg#_4_! &xs}δo :єCFH'Rlt;D圥 ,9MfYx y)A6.L h&\eW*!q?@G )e]':[JfpH xbs1E,rD}-ۥbɞ ?\~WUoIM&}󢱢<25[rLzL^הqW23_=qҭ!MH1 ģ{Q:,ۢ5zHimsބVMvۆ uZk|iDQT4LuYU.dഠfq|YʬD/旱ס^B…ĮY&75f-uhOz-̿͡\ARotX%{xK(SFPEbre>9kI~?,2$%p@ ~AI!C)xFŸ~>t 9R: R9@ /' 4 €qŊƸyXc~zx ~F)-fR+oGeBѼ/䕞=}?ҷ&y&P^ҽ[jc'iH׀/yAotf1] R޲҃5Lᓴx?glɏ-|Yq9"Ȑnk #F' j%rzO2o;ɬ5mƭ!bMCf(i30;腫Dh{h!Q5T@)oc B4Tm

.>)Iw{ H/'"H$R\DB'l~OL6O6*|? W)e^5d bp7Ė⡼W F^]ZR:ՄRZS5+Tif5RzWt9Ce6,bW a}I^f77'O|_|︪fB!p0;F\a$νtKggS&jzCڹsX*sB30B;I ^8Ai`B%O ;ǔNtdC܂#,FOTc"W endstream endobj 240 0 obj [ 0[ 507] 3[ 226 579] 17[ 544 533] 24[ 615] 44[ 623] 47[ 252] 58[ 319] 60[ 520] 68[ 855 646] 80[ 662] 87[ 517] 90[ 543] 94[ 459] 100[ 487] 116[ 890] 122[ 487] 127[ 468] 258[ 479] 271[ 525 423] 282[ 525] 286[ 498] 296[ 305] 336[ 471] 346[ 525] 349[ 230] 364[ 455] 367[ 230] 373[ 799 525] 381[ 527] 386[ 527] 396[ 349] 400[ 391] 410[ 335] 415[ 557] 425[ 634] 437[ 525] 448[ 452 715] 460[ 395] 855[ 268 252] 862[ 418] 867[ 418] 876[ 386] 882[ 306] 894[ 303 303] 1004[ 507 507 507 507 507 507 507 507 507 507] ] endobj 241 0 obj [ 306] endobj 242 0 obj <> stream x]n0 W,AԌ̦`;}Tlܩ"_< k/;9OxI]BT= #wH#e)ё(DeNQ5D5RA:Pg9) S/Uȩ O#k.=愣 3ClLޭu[4<ސw:+ endstream endobj 243 0 obj <> stream x`\ŵϽwr7iV*+iլbK֪7˒,r, W٢BSMh SkL x$ !J&ٕ%Cg4͜)w̙rW#~1pwЃN~2=5kVgv-`hoЦ /0}p@k ОZ]/xizۿo/@fֿx) kXe[Zs'kma}n͆SV_2l;vځU$c?(Y:L_jI#]N|peXpW0p-Wlj6m8Tkl޶=؟>ҟ^0Њ-k/}O*=|^spoi @PV`>Pach6 `a >\F.){[M:¹4Hְ4MMcA3F r1Ar#CMsaHuP;9b>޲̟!ݞ?/ItN #n]g^9rU8uH_q_g/ˤyw<Gchٿط'g'I{tItI;zx? 'vwKog_}HKKKKKKKKKKK:1B >A0 .14ȅ6X`3 p3w;.ńVTXH~Xe7QeاK* b x|StAylS˨Een>S >yQ@wԑSP )3uW~q" pB<1DgEv;_i&I 6Xl=PwׂΎmZ[jkUs++./+-y=iNAiT L*" z#")O{P7EqazW(^2%W($%%)U9z+rw1~qmB\*LXUoY[PHÉk{밽 yv@{ *0lKeΥY?{/ R[ AB[qmD"Z.tylV<#LVfꇇϋh,O]$w,8H>`c &@EX/q  y%}q} |⤚0?v}p$+1&iG!D^>D1LLVٹҕ~]ٿg; a$kA<["O )?Bx6Z@}/Wpo ߖ3bo-vA1jqR|U#^*ծ z<~<\$M|[xP 6t0?rW v-SSNg(Ocmjm&kdFSP0'5RP~nJ5;oy]5t6%/\، g@+xІa~lmv. i)_FRpcv"Aע 6iҍBz24#9zZ=+-5]X+ƥـσ;~pHl޵6<ͫ=] SG頕jf:so:kqx?(Mѵ5={1/4/|'`B*rE@HP Ȥ #4q 2p,kQŸֻVsz~q  3w/Eg&*^^Eb^.AàL*ߓ{=OANSd&]#Xw}>FS[aq8"z[\#zQBa߃fh4Gd؂,h戕qnp;1 ̙@g6N;i <ĥ C}01!J(uE߅NRHpK 3UY6?|\/I+!R ೹{䛢xf5}|_tɸZ`vDm͟WS,EQ"#WoH6)).7a}?6 Dss3*A<<,UїT5I^3BuuЧu('uF l'EEsQGb+QG%bFRa jzuhj-b jUJR XMG,#XJ`1AA`BA7Nvє:DI#h%h!h&h"h$h 'ڛQ{ "Fsft6JIc%IE^A>A 4CIlEIAJB:K#%.' 5jH!GmB&"4$OG%B4j"T( rYځF %" IbB$a/ ೨ )'QK7|D!)߈p}J"yI?EoA:kQB ^!^!L"o ^ E'HYפEO{ D zҗ{HnH; IHO n% n!&ƕ~5#W!vGՈk !*+ v\5!.'m^Fڼy ŤH I H<عs&%HZ9TN3 Ap:iF'S'L>D!җI[6l"H2yF%5Qo3Q_o%E AD/ QeQKsKz/A:TH#%ݤK. 'y L!6+4HO=y@Kq5Q"-Cȣr,ʭ@H $b c@c0FٗX 3 bDw kiV9?aCüb/OE1{o`xk~U 8^|Kao|o1<g0ï1v>U81KFg0jQ:/Tk`êCİ_9t>_y{1tD0܃n wa ?p S)Nq S[;?A1܂f 7a ~z 0\+yΫWa. W:/L~R K79/FEaγ22Y:3#tƞ!Jþui;xuGP':5tڞSCN Ѓ>?X:qPH4d>|2Dꆨ!!n5(C `cp`dP4'2 |$ؾA<}P5l mmٳ9izາ5{քV Y/[+ ([ZgYhiВ=C=e",;* -j/м=PPcYC)\+OoM=h]1;؜6:KcjۭfKrB-Y9 A"}М&21F~lUu<Fi@C-c|; 4tP5j?bj&.(mШ*SP eGwFTС*E*j`(E'qQK #< ut[G$iǒu~;GK%uI^/9_ 5ԮpԚN> ,_mh߿}9~,߶/`S~^lێi i#+۞nZ:rgYՑF]~aD.\ QxV1v ?; oe۷pA<b&~aUO”^:"q͐mbW@.Uϣx0]ŧc%|>G'mZwZ`tC"v: {`VX P_'0Ͱ p; p ;< N)y;D`gMp\8· t0\|^N/=_WaYGt\ ǘ|ޑ7XfKe7ԓ G18 OP1|QQηofLj$mBgƦxYy'ap6ΚRgXD[|D[SŏIɑqOEMt $sgjvj)[񓟇Dv\|9;1F>nLߋ#QA(sl`c F٣}4]7 'voYyܵ~-`AD>xUS,~ t\n,9 &#39m|uK׾;oU˱r*daыcXDߢjA~Tc4EwTZuZ%x~6b_<&+f7/^6q-{WRhL<`*hW'l)Un\`fW-,uB_4WtV\]5N,+\9%e Q[jV.9]SANf4IM&ifMeSA :LFf4^n)4!ddܰb~-Cq;Ewnuȸ M1޶bE$J|BڧT2"O_N3r-_0j$fz,cQ5XբWMpZb5*%ZW$jlAx56XM۠hp\*?R &7wv@ŝy*=M\ѐpV}bCpڢ**P ˭eZ%EcRE" SETW_`}[gly5p?ALz礎R{}9h+w?g|##hփlNFO̸|T1{å\ty%6O2EE&s|{H|>JEFp)#J68lVUlpNǺfcuE==gELQ/6֕,-p+btsoΪU$ ]eKW]rEkpjF___}O}raňXĴd_Pyfy34Z^işg:Yhq} VJpF58ZՖmwA^yDS&^QE#51 %jR(howT/2Leh_ZpMWeTJ0u>)51+aߚ,Ft{T?| Am-LT9P5S/A;* 3dizlƴ&2)_̞ihU.^ we[&p5YB%Dl+I68v 5gQbo]a?onq5%7'܉ChbBu.ynr78g_v'yVjB◨J2`Tbj \yP1SsgE AGt0'0BFQZje(:&Hf:NntzdFɔSXrZQٗpcmk͹"G]p?f"V3ÓgMVܣ(E`y*<#1%˖ .ABmсB^Ѷ7.)I%xLKHhKZn6j;gm^Ѫb4%eF7_DDujF-<'&X @R:VmIn245!fˤJ>NyZՋ<>`,X?]wf9 Q *N[5#Tl0^o J;7h<|Qg|CY~qǕ/rW6ſڔlGOGbc^==죄 43)>\nx2UAb2v >B1B ጠz\C|b1F8:Q:cf=Y H,"lvH̀20ekWlov͓M7?≌fdQ0 A7vY Vf[,J+a+g} FFDio]\fyǟ=b٦v-49]t13 oHYax2=Z2Czƒo e#gJj(ɏNwL;Ua1ϥOfYlEB'ncA{YʶrT0Zv_zҼΖݗ4޹o^yoYe;c[ly[jSu),A.ۢKffiI$3W~P~C)6gh*Tovz6jۧU-Z,3?.N"Y{I棧֬yiD&k@C 4]508(o<⠽`g,[\_fB6M+AoZGU8 vqw#G5X)y9uyYgbq6_%bᛏWkQ( rˤRG9]U ,*PJV)5YL:iVg˻5[:Bkzk ]P3l-$_ꯑʪeե2?\j i2IE=b/> ^r85@Pa%`&,KObB-{w@$3SMRE󒺲eve XWh–W#gvɌ&V>!7k2LQ9D[J.:ҫ.!R&ɔC&܏PlPSACle۪!zv o %5Gq&/ o;rwIvr2g _o5O:n]  Ga2E~rG:ڸ{LȞyek44"NFiI" GEqg8ڋ7{vu"^t ~/8~}+{&}^~k.IOOOOOOOOOOOۃbSy vށᓋ6!BC\$w=\U~qkoi."BA"jURO2o"-C`ކ_b0c!S>3w`)Ыw z8w[dٶbmv0iyVGGL7up86aw]tqDk0&"\? _;ר`);]"Zrpq+CGj]ۃ(qCxV{+g3ơ~6ͼg3ơ~6ͼg3ơ~6ͼg3ơ~~Ab(3jAni'Ed ?e RE.O$f!be[ O3k:5o]u2CRr'Gy2\%SUy=G}"Z3.WObx>3J]ʷU]IvyNPq4S+?,|G3PKqhwSk>m֘: )iIw?V#mRURɮP4Ip#; `dcl(_fP6|>*Jn'K˹ՖQmFC3T\MFݟ:骿ɪm߯kdLZRo%{L~ιJk/=,Tz3SyCFq^Cr&oNeA( * Ԝ4[9?2f)j|=m[=>9ҕO"%+MͧK5e4Fpaz[rbΫ, FWYt9[JOKi/GVL=i֞Zi.kLHKL[8Vtu-Zj9O ?x52 T-P- hGQ_y>''5+$CF3|~|7ߗK賲2 2| 3nI=UOy:2ܬ,<`ǟg-ȥe^$SzfF/@eY~d rS -K^6]eނ 5 2Go6/硸MMYy_ځf4s򐕟{檎MAB?g$A3+sSi 0?t_*0Cs))ZBu>-&R},y>%~tH&HgG$8>h/0eѼyrKYNSUAחE4je<_V=##w|ITu RߗfFOt4(e!3'<=Q^N~jGjjJ`.>~?n_!^d包Lo"G#]4j]I8y hs?]OFDh.~do][?:Zַ:/~׮~ֿJwUg$Y_~tQ)&X"k1ZX1K)ђEvXJhBTkjQ!j|'Yk0>a}RDjW_Gn!r!Q>ܗ["8r 6F vkAnrA0ތԾG]2n@ _!;C N‘xGrvAnOވ[; Fnr !>}ۑ[~s ӴGMu\c;s܅}"9侎ȭFn#rO"; ͉[;U֬ruF/E-rC&nC~ﴥC[uJxm6{;rt.DnrYЎykNGĉ%%%~oRRaQQQӥ9ݩEEHC${f r?a>)EE)l/'N9ST$뇚FVS:-Ӛ$k>$Y))vfyPid}a38EU"yvj֓Z5VX6QdaeU[mT_8ŭ9S&,iVҪNJv;dST~|]s9l6[W:=jٜ˗/EsnQfVf-9d~q4io1ĉ;eg\\α'Lw„V'%អVWS˦SizIRIî9cO͓:{#Lsإpۡ[UEEjSSץcDPoUs[y|TU^: OIasRu>rbR"}l+LϨ)D[ֽ6g".L%laޯi36mae0Wc%ΐˊZݑ;JI/99tJהݺξAp:7p=amTSUowߦ!υ[pum/+B 9yypj.M,moi;aBD#Ԗ39PRt9.ªE9RhRPm0VuWRVAKp:NBwzمW (8bS< wEX-6ʣͣax4!FoCO ɽWM\D(RHkJe-"zdϑ=ސ36Gٝ;w厧> \Ҷm۶sHyDxRg{aZLVq3*m*{,+y^VԵ}e=111% ?;wiD!RdKSJm-SOӝjj:`';򚈕rif7.Doؽ;2L$ [Ü9lXfn-L 9,Nv/W'IXg#i}9\_|1:'՟'FYtΙ[INbUYbE\ENe>kg>C?u.ȳ衞HֻM+0'X-Euݨu}>ŇW]zX]`*ʫfWXuMP :[]sSe>Ϩj jyuI+>`"/_qJ,bJZ|.rt)KAkO 8VuSY}Dou~t~3R;?G;A,ۅ6睟&d쉢M1J$-YjEO?6Yq }fu?.>Y0bvÖ["8fYbF˻;"-ۣDʹTwMB󭗶}."ޑ;D-V֐eHg;j``:!KwBkL[ZL[/IuuHS̤\Ӗ|KH+TZԵҜKmҧtdԢ.J1:b1 R&Yk2vglLfi{mTR2bϘ)ݞdqѪ]i 津`*"=ѫҬoKoOvV9Lj2iu]WoZ]?TeUI}_Iz׿LUV 9nC6]=a eJ=3 ˆݸ]G>RQ+'Wګ#ua1Kz"'l9۬}Yk⛲ĝLzqқL[tv|dֳf'_1%{4`9UNLL+sӊnvJwK9}xXq2έcza 5ȶUk*sބzG^sb<כw(eX}sێ\n}W0#K1zYsooT dy׭PȻM{WYMvվmjy T/]ܛlDꭕKz|5Os3G^yү=wCzJۄUeAhz'e=v)&{:$ڙ:Kxs um-o% ^~z_=%SOS/;}2QSIƱ9^qvL?SC֌-*͖%7ng 4r5aiy,UEd'ԙF^ګN&9Oi^un' L!n7&8EAQ][}_ и~+,\߳1>]Ky8O]Ec=+T1Uhi." ZDkYh{\بA+AqjM@ ~ZԿߗ}?^{RRW7zxzL$Z/ SV#‰ZՆxP%[Xa%MLoA+/]Bׄ.Nײϴ"karrAZ#[< bj§P pH fTš=_؇qI 'q_hTA!,F{<`Ãn/9F8 -t|ȅ{(R(!lwK ~N-# ҉D43#_KljyQ1Zn[:$w)GykED!o n]z Ydwq^7z@qڟ^suׁ+> zEq=08@G5^BX1|ȅ8X /wIWs#5?C~-_o&3h&;%OWp 5f`L1q|t8 )Nxi1N9]1 cnjWG**Ɠ\+ yKo~,1l$2F"l$2F"l$2 ZV"Hk%ZV$BĴ1-DLKhߴJYSc|nM3>'jFi$jFi$jFid$[FQldFQkdZFQid4z+^oxՓx$m-x/6؈b /ǫsɽoaY}'+O!O3y׈9HǞڇ=Z|bebbbb|m`60_4=w$s9s9#Z9_܋=Xgߍgߍgߍgߍgߍgߍgߍgߍgߍgߍgߍgߍg60 *![~~^^{Tnb9m~IDb^5 2x9 <^%x^Wal&x ^>lvbGP 8Ůk-޶>6úszC;?5퇘? aQ `,`&N8!>uү~ C" ^/6'9q54]w_xq<"cvzsK8=O=b"B∐8"$#B∐8"$#B∐8Z괜OKU(ZF2Qe-hE(ZFѲ/-Ӳ/--G[y7kEvcg=vn-:~+Osn&$8>9"3@d 2Df "3@d 2Df "3@d 2Df "3 $΃DA y6&Z*m'|GP `71jZh9`_o|mh6k:l|?7&D~@c$`H!F-pppp`6d6:nefVfEY`VfEY`VfEY`VfEY`Vg}_;F-3e`%):oGEfQYpu)4g]#̬3uu7e|i%YG~|z C" 0 n0 F 78`Y]/nI-fxHQˉu+Jbǎ#jGhCQzc0c_<-o@ +e8h}2e fqVg]2c{c}P ~85P up>zhVxg|G&0aߴXpjhK-qԲ8|\}/ݫa  ^q4Qx 'I>]xC"{-Ztȅ:kk_:!uȯso=vkѩЩЩЩxFQ+FzFs9܋&h":}DV0<9!yaD1ЮѮѮbF.fbF.fbF.fbF.fbF.fbF.fbF.fbFz#]^`T'@ Agh}'ڀҽ}}} oC|ތތތތތތތތތތތތތތތތ81JƊxw[w n.iSޔcق=[g l!,q\TS"[:h%߲L,\,O.,O?/ `#6k:ބ[6;l5~@EaR X3YTfpqVpD* [f)2I)V*TPvoZd%4ZicdI6ʓIWNX}>yu^>뾮I>/|b"e| +5\]&ocy9O0 ?sp'~0?ݸs ğ0Ox O<.q}\b>.q}\b>.q}\RʥK)R.\Jr)RʥK)R.\Jr)R7ͥn.usK\R;ڹΥv.sK\jR;ڹΥv.sK\jP^@^B4%}i\p2F0ʁ (uG;JQRwV[nV[nV[nV[nV[nV[nRg:(uF3JѨήRcrԖ3$k+Y[s4'L>iX@u"$J"$J+]XXXd%/YK_d%/YK_d%/YK_rD"їD%/}KD_"їD%/}K;@w}D_"їD%/}KD_"їD%/}KD_"їD%/iPy{x*>ڧOi8qJ)S4Ni8qJ)S4Ni8qJ)S4NiZcj5֘Zcj5֘Zcj5֘Zcj5֘Zcj5֘Zcj5rvGVvUapxpxpxn|}Q'S3EGz=бί-{T]H ްͱhE:TPV3KԪr| 7w2v^jv^jv^ڸ`,*Uuh]E*ZWѺUuh]E*ZWѺUuh]E*ZWѺ|— _*|— _)sR;'sR;'s UO***********;w4:$sʢjepcfi6r{iКCͅbv0=',}:aO~)ncs?ԗuqKŽ+X*.ůW蔝$3]QAFT;9ףJ){akܰ"}Ϻ>ϣEC/+xkmaG y~kk.G*oG%lw`koxB%áaS0o8q|X;3tޏ\+M| К[ҜyZŽ*]nJAj5cyjا j*VB-BmFm@Aʭ RnSnrymVm (7D!)7HA Qnr+jj(R(R(B(B[(B[(P(PBB PhRhBCFmF$:637|'lhɋ(KL.ES3QQHz5 d"b.Oe!}7{\\ğ=%|*{j*w?Ϟe/ W@?s.\\=e /fRd6<̓F3ڰRFIG:]z.ε2"b}4uNm򚻬v.:]:%|so>[J͗|ݾY͂o}wYF,_2nz^wq=Ez^9EzQS5QS1"fTČ"eT]J{ww]s}Dw=9*="=©`.埵^i ya{6C>9駍8ۈ}k ˷WSBak;:Ó6_tfl#Ⱉi9{(Ûq$Ŏ /fq=k'KQ}/ Cc?mvW.ÔO{=L +iEfSCTy*٫=E]Ecp`vQn67;mas<j‹ư9w5;`-\\Ocaydb|:<]ϯCz!<MDlgH8b_5L<auQy4ȣAߨ~A: ҡ}Pnꗛ~y_^ꗗ}9(3L[j sjO3<Lt(()ff^{ H-aahږiz>t3k ֢u wf]{ч(Eg2 d\S )-({5^Щ"tdvyo73{]Ch ,jÔ8׺Ⱦ';8\"{ȕwʕwf ?허+D ٷx82,{8&\g\gܐ=pwzn ӹ:Oʿg}]avptE_3|;qu:B~N]0pvw(  M2%l I^{'ޅwdSqN8 g=xo{>GQ|,ܓ'IpLsLs{3=>{\/RLpWBNSљ׮p}mI^ky4̵DGxu׹9 4^Z:tgLg.| Sde2Nz,̐)hw?oww'^w]n}n]agح-v}vv߳vٽvrE;WvVy͎y֎׎YofUr3{N\q7r"nYn(#wfݤBW٫{u 2^{oh D*anR-W+U>]Z>f.@Q]l.O bv]*Fѥrpj_׹>_ T̕*QXY*Vvu?PUZUVW/RһUV*n1rjЦzw Uh*wmhkTvɋ잗{^"~Y;/kQ,"K-bEf.ȝp3eVٳzJ͝N'W:eVYUl5[eVtʔ2eJ2a엗_"|2_Q+rEY./eZdYEV+fy,/f-X^|MFj87_:dCied6MFij+W[*tm\mj8[h-ZeV٢Uh-ZeEy"/Sy2D &Cm@N=mGb&o7S |og Ө +BtO=sDzŚ[cg{M6jxge%++yAXY݈ٵ]ٍ]Yш̨dF%1)MlZb,JNE2H]KhF1ZZhFk5v"EjH]F2r-Ro7vwFnQ筺#F,5sAluΙ>,yiˢ3ƔN;=lg8ϪlWP!UN5H띡,k#Z*Z*oY#rTn]va;ީ[kOlVjnu,RHŢ176ϺH--RHO b ̡͡՟lVnnVn5T-nӢZ3֚3V6}1U+_|S690PSMljNTXBeX&/˽j#ýV_U*53MrS/}ї}+/KR+Z29ʗ%fD.Kz^YY}3!3)YV3oﯞuJ-tFR{]77a1Qij=m N=vwDu-[jm\vRaJ>j>lt+K5Xc5pGgשuRi?MNpOSik_́}upOGo~}?yc'#Q@x]v,p*\r*(\0 -P@u bl|3tU(C_tҰff*:wUЎWxU}H>َJUFê_^XOIo?ڍvݨ}X>ҍtz%;-TQUg4W˲z3x ^ط~n/ >BTc.C9N'p \q8W+zTP;z~àaP0h ~}CU} ([$Vq8U*Nb'XI$VD )Cݔnz~=@?%vSb߯Q~u_Ws[I6X&kQkٴCcI7kUV*'*ܪ七;TSIq+1GVEww"ҿFҾ6ʈ(j#iH#F1҈FT3!XckgF#f4BROX9Vt\a?k?='C٢*[ՈSve=m=2,G̳>O"\O3,y)X(<_2c ^Ұf^r>[(~W`%v/Bw!śC#oC;[w&>/nM´1{[Gѡ3gaa/AӃqބCqN8 Ļp.Ƨ|\Ie|#sDȽ^en Eqh~vVXY{f'^܇g9xo\3n}X9n6׷Q Շu@РuGp:>]?ju$\kqC#r戜9"gG¯cFx٪6}5)~~<෾Gy \_EЅn ^o<{(,ɅQрۈ ~#HOd11~J_%Ưxq>IO$q>)atfG?L]g69 G:S:S:5P5Ԭfo~5"Fֈ'PO'g<3iU$sDd9s>&4smWT+SOet>,϶ɮήֿG aWv/:)usl:T{}t@pnMSq0I$WLm]UCF,O'e2z^Fy=/e2z^Fy=/e2z^Fy=/e2z^Fɟѓ7ɛMz&=yIOޤ'oғ7ɛj5ִ`VFAN5U\朰YEe>pppg.I&ܩ:ܨ:ܨ:ܘgתgfW'3(]ˮ [TT#TDf;578nTIT(x}@>UXUXUXUXUXUX7FhMtn4э&D7FhMtI!~+0 U*Dg&g&g&(Vb(Vb(Vb(Vb(Vb(VbZWKj^-ѫ%zDZWKj^-ѫ%Q .R&pU)*\^. :DG]P&KC. *oʸQa  u !FL@ GeuwA]}TʸG{| pN43p19?`zAEƺ.K/ .NQiST)uq+6L 773UߙDU7+j[1,ؤ zF8UJw>lr>lr>lr>lRΈMΈMʥzDrAWNʉ*>KUm'0YϜ߈p3n!vUX? D??Vc}uNjX_'X=vNtu Ntu~;o'DvssssU/_O71K71K71C71C1Y1K1C1Y"򺈼.""򺈼.""򺈼.""򺈼.""|MQc͘t"UM ޟ0Oِ6򺍼n#߰kC>b-Q$4asCպ46cu)76.X ѭt+9JNӭt+9JNӭt+9JNӭt+9JNӭt+9JNӭt+9JNӭt+9JNӭt+9J[u+n%֭ĺXVbJ[u+n%֭ĺXVbJ[u+n%֭ĺXVbJ[u+n%֭ĺXӭĺXGGwӿشj4kѥ5WE\}Gk]Dty暱#‡ ^g ^poedЖ(ђavn0 FN6vN5Gv3vѾm /bށK9#rX]6f0 fqYdf8jȮ˶z-|=*%V9>gձ>OߚmۻקӟTӞ|\T_^ T׷|YKf|GY., g37;?5EyUh˜6gUsZj}3ﬕM~+K>jNjÂhPG#& Fasš\0݁ď1pfn:%u|\55@qބCqތvw(cp,8SC6Lㇸ3#܉ް>?q?a}|,\χЛzE]͍c//hhȾwGv޵].{pAvCxsںP۰wGkkC]턽kpAmaApnMSqOaM<KP۵kPw8Px?R/ ﲞ1RrKo}i*.F+!=D{byt{cn Lº!Wq5٘ԀIy(P@>(DO<6o*jZM={6lس g`&M={6ll^ `k%Jm;*6T&Ŷ5Q,1 ;[)XmǽxqcM˖Rsf ~O : N JsN1C~ᴡ.PJԃ 4GP-HaJr1`uzCN\W.V `x#g3+HHN.@;o(:w G}I!5KPR20aaLc8ux\E!۪%hk۹ )BAb; :HYby#a۹WKv; l yFLe23!̳|$큓j \eYي:r܆ƗIrp7٨-o٦|pp_r7[hNil嶶eǰ Gћفy~D!f>pFѩwz8R-2L!H<^պ"amTC~<|<1\)%% aI0~n>J%,I P4Jd[ 3]͐A¶0Fqα]8jX9QzmyP.$QC>m326:|A{kk(ډ('GTƩJS ȫȫzȫ;ǩ U[,BN,N @:k zHZx z GmM].LR*W>RNMFz]CZ}=Z֣;V&7R)aE^4Ƃsx[REF㾐_5_uVPC>jTC*2gUt;;% +~"K4W_N )ޠ8ߣ ʤV8ɪ*4Uggv-JYwֲ֝?c nF7`(a6g3dDbY* Xuޒ_j-;V_ί` y'މ5W. ʻ{Bޏc >]̇Xk~C=?.gY'<QbW6 Ob<lxes٧?&q-}%DMY1l('ʱ~Dm+걟DшME3@4"B\EKъ[*:Krq]EwV(z m,W< a;??xhOLXV|ib;(s!"Vqb;l#4N4: yN<˯p^p罝I~3?,vRHgɟrGn4qn[np37n';|+rw9^ v/B X)R*xZVfYU鲶l3eفT$AC$+5QG).oɷm9N\)ߗD9QtdMNSDwN\'D9[7$9O dI.E?RE";eC.W%)Cj"U-T[j:7Օj1FuQ]8M]/Q=U1^W'j$>U7u&&{ԽK5B_տ7^T/yuYFj@$G"M}>5QVdVMU:V\^j:"(NS^) ;{xoS{{ĩ==TFzO:577Z7[N]==7iM9ͼl|o7i~v.{NKo̹[txN[ovx;K߼ߜ˽=犨Qm+Esѹ:sTg皨Q]Qݣ;]zFr5(fGԐ!΍sz>| L Lt&&;_rn|ֹ%0501Xh``mgln3>L  9nvŅZ7>z740Uh;%](ѝ v~ -r VɡP<:]Z] eCBynzhWh5/fnh7/ǻ{j~u_ӯuz~)F~+m;*ղٿV7~/l`y?&/e[?O"OKUy_/;MZ?O] ; WG({G o9VyWLK=ģfU!ՠ[V "O_tgfs7Gx+͐Ź(1x@./ި7-FF4yzҙEyE쓔7)zQI+Pܰ4_<ڊ";@&ZEQb]Q($A:Oѻ?EI J?C'eLHpR}F/6 2t#V@PG\?=bCBu^6)$#99'p..6֛ط>ٮ/ƿg>Sy/X9aݴ=yTsº\LYWsbc:tceNzEr~Vl<\4O;Z0W|9tp?sR9cb׻ҿ% MzIGwt}g+Q=/G~畢 :iҵ'r-QrkY:mnCVFg$dsk#5p6:05|tmCpqL)*93Іk7gpQTԒC; seW5"1t F܎}ݦ;yBI3 C(@=Zl;5sġBׇ>tL%JT^@r2 ShZZV-@BZAAZIWSNzimvm0wMi?ա|uzT,k5Ha52d52Neːr To<ө"·P<πVZk8k*/pXh-G⠻ qOxTIDAcWby07CX@dw$lg'C=%Z4@AIA\ L , ,FY`qx,Y "΀z^l qPrBEIbbysZ,Ǐ#m0F8¡>PW}U-U@npq+U.${HSEJ*FiWՕE7\ ZDH1&@  8eQ*[ݍu8S!|@=j$RєzZ=mq\S# )kZFR )qƽAA:e8>}>CsU};a1x',)]㔚OQSL ZteѭE-UT Yh1RLX, z!/E,ss ̥@ Gʢ",&YSbTHE@w(qR vAJ+pEY7HQH Qqj0QbDň2##2PgR9~Zt1{4}znآzN <%"bxO9E8v9D}iײ»ǥqyҫ uXǶ(~;GPo ,0밻{kO*#CMacfhޡ[ ү@}{EC_q;gszB?-uk=Ei詂~OOiuPuڹ5Z'j;vhisRN5έ]ƈ,;呫Yz3~iDf'Aξm}xf=^ߣo^iѿŞ1fzjA\Ch~G߇" += =3^i+lo}؈*9l<7c%fȘf sǢt3qcEl+ey~#cP1C.a1ZnW1(ϮiW7%RJ|G#h_ }gxVx,~UeZ<z?jETx9mV%Fޞo6^cf?]O<0}N*H떅fĮ~|佬t#=QwIkyD9osR{3iyvm,n+5N(5'@K?~mx>݌=UwGc;[Y~;e>кRr?x?'ۯ蛣?[sn\[SB"9H7\,̬%~1W_Q[3_l 4<ӑUYq{y[bkd%Q:uZY>Y,;wѷ/E)Q^_rT(M1J-?怽T_puvvKȯ@+3b;/L~Qq҉%b;t,MxzapRaN*8Y{E?>Ik̗-wwuVq~1#1r(R**[U6,~Bn]?%YҾuD=q G1/c=Jc}Qҳ`{*" K|TyҤ4H_w-Lbct_R^9s$c.mkC6PM-Ϝ = +B 4߮:H?}VVe鲚t5sz:hM,|w9-åhCaJyqWlW'pVK+w:xxIs:J7_,}#Xk!:kBw[*Ugz eCi${@b/B*d|K*?6x~>oA_}cThBkxJ(!'|S4Ji gRO|_@i|1OU| _Jkr4FO ʈrxCt D]Q71P(Wh :RD\B+Kh(^~㧄?%7~JX=g353~JE7 km|6nںn5x(a%㡄u3JXw㡄]g<덇e}W6x%aCWvJ0^I+ {x%a$u㕄7^I㕄$lJV$,x%aD9ht㕄m1^IXJ~1^IV㕄e$lJv$,x%a{Wvx%aWV`pnpx%A㕄W7^IxC㕄71_|W*z^*ojV^]k5mfy!/1^Cekx WxzNwW!»z{_nwK ƃx=KRyooVzi "| o5Dmww!|‡!.;7Cw!!;?l|'/>_ |§_ |fplpl=_ [D-Y2"E@Xi6",mEضaZ="l% 'Tƿ|0ssg ["o- \ bQEk[ S]QITz2Ez l\mq:;k[tmѹK/}:ڿ`E@yx̀ׯhg urޥ )8UO&Y4)`aK87L&$M&nv7僚[ rYHnEJMqssۨ(hrwQMe0%sCV{ʺ݃gҮ 8H2( BܑtEdJ_bdC 3JYd9YO#!+ e .9RCt|XZ8R>Im?ST^K>M ZoyyQ^/W+U*r_(3Refٷ'QS̵#}OCj,?QK=9s9eYe:uQf9k_Wsyxz^'׹}~$9J} 1>,Iq̓dyHijeOh24eST&=yF "y|4yV,j _Y>K4%XyDVjVg>Lɀ}d@APd@A1'G9Nh 2@dE  hU45j6lJ@zJ{  V@wǵ@ ㈼}k'o553{ G}.s,{|$I _-Or6Dm`YQ_{lQQzhTET|p{-'zm{%YD~=ńF`"g&pa1EXXyDVѳ|N$,;2 8@A$JeR'}͕KY},EzC0'A ڿ*6Ch'K5imHGu({ǥ㈃uCM$[ % d)+Hs(za/c1OHOEI4 ҟ%ւBNN, 4*-JE!1,]%B;,M#hX!aK@Z#K`霷Xx+ .m@]XP}D{{^ݯt#!:/8 g;;ǒttgX:3 Ϡ3&p>cq@[8sg8a%oR/B9i-'*!Ҋ%ZI5H~"x"aVf aVf5a9jì9sh0i0h0Gj9i #t [XFV&>&X1{T8 |o!# EN~ s{fn? AxL'OP>;*[d@[$To5|wp>.S{?(>aI4;EP 4Zf TD888q)P&!ι3K2ܙEܹH̄)2W ?<ɖRfKA3/]Mu4/>?OlG$*ĠѧHּNqqqqWQ1p|R$%|Rc"ѤH499EH1Hq>są"qa"{笿X؊ߵG7Y>Ҩ|g -\IʂʐnWBO..5VҨTc%jS4bn$@QI1yaA `{a=>!aQ 04l 6]dB@&c2!meB]KaYX9k!ځmJaa`a0;Z`&G}apFXwc;럍 ŽƇfԬ...϶JYE(r:Uky -vx~̞1칝Oj֢]ayaaWa7`|RvxX,u5_+rf_g˹g}>V[[[WUn`f19aȹU`3Un=nX/ l`6_NF,ίyxLrSWn2߾ mc;F:g;MF ,E>?b?f}˝Vw"v]vw{q;?koA]}/%]C,tcC`]ZqajC7zwV Gjlq]e|IuFeRÈvk6pGVN墆МqR<eUe~ä?X~ k]Yp Z0 ]Evd5O-gv9%WP'Ǟ^VT>i L6{6)wsq$W[=m/S˯Y\bu%4Z nk٪3V{ZʧE巭{:ho[]r_9gh@zy=z'o n$$#ۡg[wAϷ|ΛC%avzZ+"<9Kj[n= ::̵PTjƵN@Z/A[U|.z8F7k2[okiay=X}.uM<9jlZds]G{W=1H V34_IC7xzbѓSl}syJԛg6HQJYGSY2u9\S)^\c ZoC=~󸡇<2'= =!oۆ 3N&{=6ܭȽu-_q[ Dm|eQ k]Ol761mLjۈ~'՟U6-ؘ.Wpݼ1 Wqϑ??mӛw5hݼq9׸zqpFJ&%o{-az&x\y?lF7t_J'e͗Cm_<~@O4ɶk7>uo64 Bc?T8i<8sǶ8)nn3$6f5o3db{4qZH?B I5^nlr& *oOyS-ߠxp"#x j|$ Bx>*9kYTYeȐUXlX><>GƕM觬钬2mj7nhޞ!Lf{4Ӟ틌uNVo!7ڝ"]C{YOr^<1cЙDn0nqfR~;J=~Ta.gz{m;{Yb0}ϙan^҃l\CBaZH:GHw8\ Eujm?I:BzϓGxι, "m49+A+ IN2^rZSNs 5iu~r·ߙǍ7[1zN;q48wǹAZpWkA:9<LNtgtNq U;n< fVg;ab`vub0QT/w^GyU^Gu]Օ&`FgzknkVV;ۃ67GWͱ_q9~BIks*tGsFC͋q_s>ts{U 6kݯzէ7g &`fs?B-r U_lv26SU}ö5譾4[LmwQ?{ gw{L{};y#8h N5D"x&Ō)H-ELk pEGy$B asx/ʷMC4GF ׎y͓Q#Ѵ נ#bnufqc1W5|c7F<0Rc(4y\?pIа+X+夥tM\~Ѵӕ3qeMݮlyX]6էBmЬXySx9>-7Z_ؖM.o[vԗ`|DֵJ W zSۦpfow;m6Vnsv\<@x_$;Зpֶm;w kۃK9fW"3>oݽPʕ,*o2Hs96Kt[o{F7S.zw,\Y]*K *]іToldxWʽE޲XKwmW|${7t%Y.ǻ2,%^#rjd]ͱFyݕOZտ˪Zxre=r"&K.oדne^\Qu̳.ͻE6X^v,H&F݋+@\y>͵ke/Wvu[vza(t{Fr̮^҃⺎'=i@kr;<YdYˀm9==5?rtKˈwJ[z{,7r;#g :Q@ݻRqӀckeG~,ptܵw &Iӈճ.{tM|$3M!WckKӴk{nq~3v J<;G^yz:ԈCu&uc'fs+hǩ׉3<&51Z:q&ubMkrMkq7Ho:@T5Ů蚕PtdL)kBEJѷkϨ1by5p:nggy܁d;ܙf>֙i>c gG;;v/tf/򲻷3wv/W; 7c[#-5IΕe*Hh xsb^?4&';*ZmZ6=]ieV1(["YmIԹvUk\.N/{9t_Q:"8c-' v8"D~QUܯP( -Q1_AQHR(BLEXSR[+Q|MUSP5)U*hQUPxT/^RȪURUQ}OTR+T[U?W\]ꗊh~N9/&TR]VEWCEc*˟iSWWW@UsEQIIŴX\&.WP|"~Q,Tj((VIM)O w ψ{^YbPʟֈGw1qLh/],^Z)qJBjJ%B)!4QBf&AxI&E&UHIMЯYiNhWnMRh~i5+?ޓrfH2I2?L\Yy_2O3+u[ʵQV7we*>'K泃X ,V-˽%k[.-?d\e*,ZSd]lͳȳ.ZW[Y7Z+V튋֘V\γ&ZS֬/X1ϖ I)(>a>ױ4Az: ?~««X/)77aZ %Ne\DOX = :WPӿT(wZ)xX2^( ,|@`de젇Ee,fSѓ%E]9R<"K fYod1Xi9Yee'lҋ--#㖓Yy˸err2mmeihf,#VgM&[ӬlkZl]o˰ֺ̺uVu[urzZgk(/'cj%1ad^V7uMٴ"j!"55IdIXT,=, =?ߝKhVe[V /["@s6?0y9|òcI]%{˃XY/{T:gXXao8,Wcc,%, w-$)аE4LcY=]HV<̖*:3gğJ-1)Eb cPeϞ_kXk5x=.5cP!Xkk<s{`Rs}\ aeJ!:a߹[r &*| oZq2Ʉl 9f w{;۝sKbBw)v+{{{{ڽս]nvpqOOϺϻ//7 Zehy|4<Z~/<Z - < Z- -π--ZB)>>> t}2ta#GIB6ktct9Cof@gB < iw=G60ڜmGdhmZHtV /%$'lO.}=xNPBB 1ྙ0* ΊPgXȌAŸn!14vj 3:| RCiN dULuvu|<ɡ~M䄦ìxT |-X1Wa ys~GOU1* ]۲Х6$BU0U`Dp$BJ唘>JJJ't"Y,,R2<˹ok#*օؿVl Nk@$3{E]xJ?WOh ~W XT dpQEkxAE[xQҊsaGŅR85 ^x :ghpW /g|;$;"\'QLnޤzn7%g>=eZo.5| ^y|oAu]ƚ1' A|ex'2x1xM5S[m;Ac}zg'3MQv\5ޢp=lwA(]ul-ۓ> O/..4;E-~λSFxo1϶U̿ wĞG}7pwK _g}ކ i6i~?s,1-e7Ơʼno,~@׾q]8o\U66+>+wXV~ƤmyODHb,򞉌vDRH뵷+ }s9?HH/1"17:R>—Yˌor>2`|9("+b66"k}ő =Gv[f{F+RkO GǂQ}._4VDOouomoCW9ɾȷ5rʷ#rW9~bߞe_s@)#Q%;5cNEGFy},ߍT>:c@1Os, FE<<Z?.ZFUp/+ꁌ r2J5?/_/n+ѝ<~O~Fw,__=_=m7Gۢ;P\]wg;7FEFojl[(?V)rk.bn((_?G$\iM\ jV[mmvvv&kipvyEe[톢W2j%YIS),e2]m[m[&%UT42O)?^)EE(2eFYlT6+۔bj)Fe-&qP9*mhk=~#OLihYH&4K8 2NCEpw .J8gcp&L83 އ3q&:gL4gp&:,E$RzgY8}gL4[Gkǔdq~'3p2:''tTa6NFh.NFd4'Odt.NFh;Iy'E8NF<7B>odtVPo+ĽR#,vnKVCCu`3نqWUzyi;F'nXoHo&gOú"g+HS$ IX?B?.ꗓ4a O5O)} -Cs!i(bt#hMǼŌfJ0ӌz0h&κ',N,>YtoꚄɂ.!;!w>ʫđU}|J>[|S,˷hi{$_,)W|A>Iaӗ7QO'[L'b6%CB{-uɖVYiK lʯ_%YjMZ7FRDyt,2T-eML93.d gMlgMߗɕ#:K΋%ei$$d􌬤&W\,$WKT?L}m-%T|zHĒmB^ݓc6`7 UնyZy[c=tƦ;'GKd[f[i[#Y_'jF#=E>ٓrdmݭAvCgQHAwE!_Dbk,eJ1[`ϖst{}=F}-̀.Uۋ)-7sT B*dy4}}}}W۷$o:{#{5td? 9ggIVN}#~aXO8348DG,9GI{W&:f;:Gɶ%ˉ.tDNu渢׊.`D"õ<ߵX7~l@.cKl3 * gxphWQvPsۮጆE:=򝄮(dz{.d\W/L}0l$I< P`,>+G(Iwb0KеP࡫Wbuiו5+|(HGƊ>X=mt]Kםڵn|!6VŽP{+ vx1?_ ?z$~^cqc{6x}|!.UUKTpp l' n2Ґ2տ/U]1DkWJWAKɐX.D~Q -76~^'ckX~8*I^Ha]}'yr[mV=T?*V%!}] ekۃq:YUvZw [z|A׮nIMZ9$ VN6vjO3I]@Э㚟so=>m+Z9|T7&Bkנ<'Q,YFkՉy]k[z}dO=[Q}t!O&|#٢XvQRld)i!D]?xi1Aax4?Gkt!+$yjo!?אLc:5K<;7n:G!K6v&懹,N^{|V$he5qh}c@׾q]:7h,+7x6wLٟ%]Yrzb, [T_gTkcUhe!bB6f7 sCY8`ְUlЮ66agTr@7 іIu퉁{,'&a9So=2p Ȫ'j&R?$dBꏭ4=:Eu:aOZqS[i5dVZA Y:úm]bPUϬqynmdlS}bD+ŇV=VǬY)R FQpZpZH0of! J##L$d]gyBA!xA2J:Ff6NB݄F>A1B+pZk9zpE׿F) "aaڶ$BH''LR\ 3>' EE/!_NXE"'l"l!l' &~!q W C6iu$t dSg0YDhB^3Ʉlu,&Ls4"$B1a!T+Lph+4&U 447 N)(,*Zp]$4LJFKRLi-Hn u3 EapUV[%ݕfǞ@V>z,YXdcdd( kg$j6*fffdu3r\FVɒb Rs,L(B)ޢئ,JM=vUpFFv!u4+[h8|߽a0GQA4߼N0h01Ss-kׅ1&^!|+!|0n~^?8(<0B\b|ʸ 峈s!M [/#x ,gчB8Qg:IwP-| )6tU)wZi܌zMuMp|.< @^5L@~6Ci(~ (R+|ࡨ?D)5\AI<2B ϮXq~h=ģУ/Qː:.O?aTu($r#sPq*kw}QfK}ч>#_utzlQEH%8w_@'QȏOPk*׋6yݟQ"pY7[j>9p}GPqw_{|(ћoS&ʌlj;D%}2>6>O̺ Z ! r)xnsì?> b ώchW7ho{\6!?u*0?jvnd7Jyu*pz wYe q./(91SKZ\wlMdc P /+u*0Kr;Z 1?| WcӴ`/x10ɼ 5u5~u5 %7!!%P0vZjI3y4% f%QЮs8O;r7It: 0G(k>%)(IA SG▐SOɻ/jM_(OdHNdHN#duy|YS}6?^+ qAxZaJjdA>h}ȏ1}x23 VsHp7w o"wi!lh{(I6˚X]cmJ[lOs`㟣D\e a_M4Z:%ǰIۛIT> +滳q^jP~X>˧yy5j2Va$zdBߣHѣnJa.>%SQPr^~rˉU<| k'AĿ2x}{B&%xȆbz[־т3$c^>C똵1̂wp,,U4wrtY}~0|̆4JBKH_ρhE !T!E8f*rZȄY8qEс-h{x{}?e61I,>ǑEOO>]'C>na z=Xk-$"\tG7Eh1<u.xa}Oě'Itq)%ʷA4fi@Σ(m*agxMyvUxH{-a^hBOx3a*RVJ*`mŐi2V?4 /uSPKNQ:פuy|q;> 9G!(eԗDEIJ$5Royj ?ڴٰ%Et9mByp+85CMw_VcnMx|#\Cu/bBaLLFj\QQsK%Z#/b/EGxPqx#أ(!tB}7U`f|w릷9GIPH^2Ga*oԸ\]]%1)Qc G0r_{(LC0D\G)g;?Ay^baCu{%GP= 꾃<up1gn!y=*]>|%Ǻ=hP;#>^_{lesį>3U.!m(x;Qء`[qC_{QS*s9ctcN`|We/[[?#/BOD_n2n ֊Vq%+ -ߋ/jE,|1R~ MR:kQUݟ`GCWoAI)lnH|#R>愷XG3o R}멂^N}!g&ߥAΛ6{pTm ^I˱p$t`]6Xk qn)6anp$`x >(XD~;qAf΅ MkxՃ )KL {93nA yC $#vqj*5BL9!c2znϾYVc=r#m;:]bP}7 1Ewae^ ;9g<c5ОQd݈`8L<HԽpp(H^B-5z%ogyl@ޭO1r{}7/0$df&ev;4n ^OntڟYL砘2}~߂sMǞ'TZ)Gz*|SIԡj[[z=DU,Scg ͣP}Sr x7|Oax{DJp X~Ey6[C3";՛ba.2'O |4v}tgt#ݥ .Sωv:8FW^H|z w %:+Mr2Z- kXCN II σW6Z2혗yxh ~\*3 /6lљsG`6Vulkpx8}S,cǫU'>XVt.rr->!פyv;˃ ;TпyNɇ s|^۔<س.q=b,< 04ǧbiq>=y/U+Yx K jxO+e?&P7YX&/3)ljݏG&x ]F+Jf9^X>A"%Ԫ _;|93 L=W?՘(2j1O#FϚ0q2x G42*+Y 㦒RVަ҇a\;d?|ɰ,2>,)]$)玪qDu7!zYKM=J{Ԫwϱ6Wg r77S CsFT1"|y$2OD6 (ilψp 򐳈ؿ9]z!~nADWA=Rր[ uw?XV"WFަwP n)C]/QkX|'`}_v8\]RcLy UFJ}G9Ag1i5~]Ѿ^p>DS9ʮXE~ d6/`NODye qV>AFCW gt-E\|]2φdEzYߠ/e;r>fA7 yƟFbw {QFna=F{y1:5ѵ;Z~&p ,C֏{E)%ȋ!QiV9%JifӨ5* wQro$;WFOr~W NNRzwS2\07{͔CI|eUsrYs&[*t1S-eҳZ +Mws̡n_nwJk)W pO6y3L%7մaOŪ'Uh!Rk~TGgk>r2X< L]ʰXv5W~#MVnf{pPlo8g~[= %}_߯#~Wٿۿ[WWB^f<6}?Ov|w|yy?*-ZIݧäeC~9>kH?su|?O8~Zw_[w/T/Jco4W3k<,;!C㑷w~ۯWY~?ݓ7% _/"n43/-ri\~Vd/>7O%f;vN_T9+އ6W*_bYv:rXnE>LVEMp?Z1!_< vF3UzoKțO)p.#^#ԍcs,!3.-ތ|yo˕!G~|+|֥SIwI͎NX͑aȧGsfj4S*+a8oWEEd4k$;5_[)LVE6}; ˉOZ?.b9qf6HIp\pdA#bZk߂ ȧa3UfuOM{<Ǩ?H){$Z5hؚiѾ#_R`mM#O .@. zmE;jKR8`s:TJ _> Kb7<҉q0cx9<^HZj=/=i%l$LG&V>;+ KZFsқ 4h?$zI4ϴ8 } XA/XaMYȞ2̣q{p( Ѭ@H QuFk>blR@]`eH &1Qk.}'FRv!wp=z;zvwJɄAoVue]L1'X! Ț7!k/\󐵚 IF4ސL+}ѿL6`iX'K0^D=ޢD?%x{}weN4ľ(ݦL D ;` ikfA}sߌ`P[ޢ~ʻWQw&CDOt~o.o)M.oQjCSjBY1ɺ\0C[G3.%>sUd*{g#wbXGBnM{ڎl DlRA)|GP3[ ף4|==QT@P3]JBۉ 3U6iDi}h!\USzΣ4KGa/LXJЇi=l!@i~R{ʻpvO4o) љt2t7~xAO[ >ɴ~˃Ql7NCN{39}F:^bj=?⭻'Weg^qW`Y.>LջvECNӆZ.;-hid=Qga&sW+!{n۱Y4gџf0֗dz4-r~aDlYIݯc"uͯ9ƈij0 "^wjDz9L|"74"Vb b4W!C?LFwx5,4G?JfGc$P&3N`/sEf3O92aSYz5A_rUl)n+XƳc:H4 N<y2㙚2شvV4xY `<(ev=sgѾ;LfDo[t}v\,d%#(Mr\sC;sC.pm%wk<ךgNgկe 3>u|>Y<}Vy7 OMd3ٲ+]̞]2) JsE륳ݫt!WT%&A@(~ETyXYϴG|6rX;\J8}];Uֿ9go`t^|VbRtS:_gѿ=Ɍֿ^'NZGv!WP~ǯ{W-Jr7? 7d]"pZK_st3gJ$MxRygt_Rht~qJ8, ei`pV7abCqoݎܖlM[-qWe;3cP-yWyo':vF s&/EK.gt_}V(wfe1ZIOF\ r{VYu)gux*+~^@ϕ7%_B-c'Ї%'k8OЬ*">Mn)qmL)>2U(Gtw3#q{?SbZhdFRZB4g#nf>=8z UG[_8مFyxfaPa |X:aQEa3 ;Nd`x1aWo#X8NpVs|`¥p9\p 7SaFH _D, +ª7oF5l;ǠA'`84&p6ḇib ~pcae҇Y9xttǣ|yK_1Ïyǜo><1#95GU}^s1~wm͉ǔowYl4c.Q+=1>ǎ̺h|zGԣ_}ެ91[9zQ1絎9/ݪsB%ǜo:ھ1s~̬:xh]zzJooW?y=cX5a* K{.ǿAe%s:'gR:N&x{>o//b= x;]ulA{\ ](gʛ;Mi㮥&gLQcN2'{^C7|T5Pfr$<7,7ϙ3G'kD˸ܔI7~1'˻s⻳9BGR=]Ko*]cN;fs~gY/[[6-)w*}d%RKҹ,=̣/ɧ"%)qkw[_EL̹O׻9tt~3%>F5ڝ*{Uda.wyE^_ǿB;,z rB<"^oo2M<'<9_/#|?_G1_Wf?ؿER?LGȻX,i4Y??,+[IVfd̙s͹o7{&<a߰$77{A yxGx"N ZILZI=N.\s[S9[J-sKɲMho4&{)cھorf{ɳ Sbo1V{`anJva*Qv9ΎMkǚ*n{jqx;N0vdvnڹ;35|;ԴL-}Զo7L.2ubԳo۷M}}ߜhW~d5v9ɮkM#4Mޮ7M4oLsn4-&ɜl7ͦbVvjZmv9nM4]vik=43v9͜io7GٶĖsLtLt24禳tt)s~tv3JI1sB0])]tI>\b.N>\f.ML4ttK-:\n>twZrEHm?O*vT@dRC7&n{];RՎ#x{S ;Fٻ]R}9'5ieKm}AR׾j_zv] D.KC.2Lv4+JibW~l?fv]'g3ia_+_ۯS[icɩ{?4QN;9d3n[β{^ig?= ؃!`r،&m#ON.w;ssںya:e..^st˲+,{i˲ 5kf\.t׌nrCtts2}rd**JN>E9l+ȵ]]y׉!~2+%&klXW_eVޱލ֘q^u9'*ZΔtsO}0wg9Aʣ2KʫPޕN6f.ܝx /'{췲fqQRp\;.t2 ({9g莋J ?({gn-Džٟp\cqgfqQz_q\Ek?s\DkFV7qdGfcƑG8"|G8"[Gd[#3OqDvGdo}qD~#?/qD6񿕽l'"{È-8"9G8"GdRE&%QdR^E&eȤ("0H*E$E$E$"*E$U:HFIr9@DJI%4","rQDRyQDR壈򣈤*DIU"E$u\8"UG0HhǑ9!L825Ԋ#S;H8"ԏ#rbQDRe5"DT0"'iGq&qDiGE㈴#*)qD95H8"9#șqDΊ#.^+gǑ9'L82ȜG!iFDZu迴]W017AsaƙfL4;|o6nv'6{^l_J[u Կ67L'1NsQf(Yf,fR 7%nj0cy<&BZJ^vqBRA0TNj5ZAm/W w Չ޶{- )r%pu:RwvA~P!T */#:׮~0H +RA '(X0?FNj?85h+9o`ZHEc晗2YnV̇fȬ2Yy<<>;n^0/x7݈\{͎z.4LYlRy׼Ϛg9f~s_2/9ܼC7mcꢞW//12V'ݾW&/e !yX#n?&3q)OȓOlyFd< 2O^,,)o\He,e2{LޗB>]HVjY#ZeO3\/e|rE6_e|2wEl]!;'%eug?}XGaۑ"bAFEPŊPJAEDK{%ņb{vP|_^s19=gC=FOS =G/K fI %aiO:$DH҉t&Q$ĐXGII$I JI FRII'I$=H) 'Ir&gH!9KΑ"r\ %r\!W5r 7"!woOyLyN^y 4"(HI!T (!V҅Pa0\R L Ke aFX+~CapT8& IpZ8# gsBXO3޼,bxB<)OgBxN,ϋċ%xE*^7ě-xG+&ć#D|*>/ė+d-ִ - 4iڑI;4FKhVWiZCXkkM\kZiZkkm-T iZG-\"NZg-JbX-ND-IuՒiEyvQ]֮hWkuvSܭX<ϜZ"N-ĠSMB&* -ș˜p޺y뚰JXs)u13D%[$;9vw ]|֣ m>~_'"P$RJ1+ ;uCVUBP(`/=ͼt{4%=*j˙+f+6o?0kLlA,{V0!V+CnVa|SdQlQ2 [rMH{~?#H ?ˏdQ@|z"IZH$$I 2/嗈*ފ7H ~Ȱ뿇a L{A{^t80m3;r6 4dpܘ7Yfù3vLVl h$u3HűkE4Ij;@K1[$AjIFjƩj&]ԮjvSS45]fe=[=Xo-ֽgb_MU3`#pZYzdde?;vl\ᶸW8 9㮸+)8yTp|< 598E($Yh C`2 _/(2|ƒ1d!/|Z^*z|ضߔ_*~lRZ(U(IzINksd[J.]p7{VbR 'ȗ6ǭ:X㌝Ƶ|9n8(N"UIHեRMY%H%W"I)yIRGJ$?>>> |§\sE| _WU|8|SDQx$<OgsRx%'BUDDb֚9@P9H"_)j!\!1j]P~d@H:Ɍ"P$hH6(-Jdz,TCQ)4Ri> 6,2QyF_16Uv+Z4T{>BGxcXT qr~7-Ļދ">7W֭S4{}7#͌+xʑ7Ѝx4؊JBA7v$' @"* &!E)B%;=dSRAJ TXd;U1~ 4G`xe8^y@u͝\/ + {@bHwu.Zŗg -hD^#*/Q^/y4^/^/;9O,c%EqE7 eԴ67 x5na|bԨ%lk蟉FnFq(ݞ'Fwl}zG|GGDcB_($s(<*&ϔg"ۑ`r*'T_) iQ$PP:hc?h{(s4 _cxy X[6^h p|xmVo҉F@tEh2e&!6h7`Xdx48B851Pz )[Qh?|'O+&#_yk^DjGP##wcY>/_GH1):R1vTWby 2 7KYi8$p9IL(!qȊqH8r998dqȖǡJq*T`p 6K륝?'CmZ+Mp+ LtL6Gwx1^x;ލN7~`"*!@gC+}>W_/֗+}CߥQ@? sy~Y_o=X?_,ʬ5lm54265;++=fs]5g]кf""27=5o=x.ʞެ\/ס[ I=og~׋'a_0 !HLQ3?{'8ˇɸ~2C4!53R;'_$`,A/}y};+n2?Q?Lb?Loǯ ? @Ԏwi2ugh vסh'w🅯>T],{TƋ38 Ξgk`cTOd<\(+cz5 CʏSΙϡkbIڜDLPgP{Jk(;($P.9Tr9RʕHe(W1`[5IM(;g("f&(&æiPNC9By`0 J(P1PRCT(I%}e-i @y/SdGR VZn V+4vW7"3]Az"h\4 rsD-~.ǿyZw=\\`G0#zs=\`G0#+$\`J0W%U sU*\`J0W%U sU*\`J0W%U sU*\`J0W%U sU*\`J0W%U sU*\`J0W%U sU*\`J0W%U sU*\`J0W%U sU*\`J0W%U sU*\`J0W%U  'WQ^ْn9$/۩% )+ ,q&لE]`1/bޞr^8C(BI(  ,;h`J5+,Ӛ~48?/lK͒-|'L\bQ c]-ڋ&[>bml0[c\]2NjKC3'3ȶ%ۤ$%?gfFϸFEK`v)I.aYqNm[ʗܼ,O:OH۴ Y/2͢[MpPO,U7wOLN4,) ,nxyUT.Q(,g$K6lhŰ_&Ů%_rKe=+~YF,O-LÝR9?3?V׀9vѶYe_&̉ Z-ݞ2ũzjװuNK[wd&)/oN1r-yw*=?s.V]yg;K9^b7>AHUrk%Ctb?q ԘueGXxeO+="O*۹įK?^wx*|ϪcJE?Wq=jJ'n"9 <"Y:Hsw{&|߾6XYtnWɉfF<_t bKe^YYu]]zN 鮙)^̞z EDh#p)Icm c q,qUE"=!4qӌq)۝)y l4&Th;Kjɧ,9nT}^fbRRJkZyfT띷ky,UsO=VwW+~x;Ze"7?PG.G{_*b4̴[җ%~v%`HGw u}߹&mLlWdIs Z),mNW%69j1n䶼̒_7 `&ؑa ˵-9G?X XTT,e?ҵ;O@>!_;Dž?/2.V?u=OoPiCn5uYN5禕9M۴-f߬y}msͿe=ߡ-p)oh$#VwG֢OfJo?jVE3v$(ZZ+|ZU'ۆY{^-M| )|][bp%r2{袋?6beA7ݵ8.:\ M@CwrXHuT=Jv^m]ƭl8 㰵x1aq36%ۚn^^OK_/w8oKw|DxDC+/uj{ۯm#Wt(` @`@B[ 8nqp|,A`qw Ɲ_E"ot<>10 K{T+_{8F1]_Sʶp.1wGXa<Mܪ}? x\+w<;^Jk4a<~fYƩZzn/yWϓ_l|M?ww6*Mo!O/<0eƐB.--ng ;=Hu{S\Iie\Xe9{y]x6]~z~Uӑ dKS]~?j7ֽPI!j#'ܫK ~ҖRz7s1:TB32" \)]RⲒJ虒π4 ͦGɟъhE`x|?]D_to59}bK1G >˯gL|ǟ8O+][icDJƮ{wx~9KFDt"FC (RZ_3l'N=5hS ʬ8neN[ch)LqÓWovEZ]d8;}whm.?~.W~Ofz't`oO:{Ҕis 4kUSoxLrłҼd~M&)1z 5+,OhطEKc h|qs) |~œVot8U4HM.zcj4eG̛xȗwzq=Ϥkg*v-k:~Q.n={{aEI[b?gڀ#.JM[4%ڴb hE9;-fcx dF>r틚Erؤs-%LVo`%q'p};ucDZgҦ8vVd*?HNjM\V-¶yw۵gKtqD.6Hi[l9^?F .K~P8o^[ iv& {M#OtZ/8a<zA[$Im姢^5ղ!i՝pO\̍KdW%^/M3#&b솇fԍ=?Z-#S]l+m=/y'_|R7oH(gw 11~EB̞fzJ%RﭶwWnzvɳ^Ξ>NUt?M i~sތ);}&yTIyMN /:VpL+CWU=u>됼91qUfw^Jn-)CKNv~)F Q{Ϋ3#Ce-',#fx>˳6T/ywONwhW綽*5˃rm$z,yT+ÇnfxzpX~nlo$/\ڒ1'ɩ>ai ػ멯ؗ8wneV|]IPSC/M[lj3";A4ʒc6!K%KY"fH$kxSʵf)iv ;V}sss>s~/5ŖIYÇjN v g\(<90_;Fbo ni"y3B)5'A"H?*z`[#ywܑ;֓iHA~gNk({pAPQnTb(*OY8CfΣNo1E56NrlɜA:zve]Pv|+o"]_^`̈_q껚r1 Vh|Re }.:~R{&~(3'` N.'.)?1hSt)1hL`~TL-i2ybovٛ FӨ%5~ 3(*W!} &M5\TL[yz}iz?ʯ=ʘӄvx{k^$b )ɳ~rpUK|;fUNUt5.cR&ZI,&>Gþ`D%RN{EދZۤ7ğ!:r,. zHnχp譜=v\ YpٟNXgUaf5AdqbU=~PV=c&g c1Fy)\$바xRG.?o4);Ao'-WE;3tjݠ8 s=;c8WZ[5l' ]Njat>NUoNj5u!O sA:Tmyɉ}dmv9%1nQ@O@j`Ȣ` (dW19'î +0B|}.NJ)T7gyIl ~oA7Տ!Z1՛Žfǝ'z_z%)z*jf!c^>(>ӕeZJNJ0NI*Iϱکlۗ`v=5!d(6Z/cyL9gW2W᥁eYLkeGL{V=._}VUI{ >~HF+kA9kI?O ^dG[7 K'ے 5B8aߡ@ Gc,pcY~)^E݋ĺBNorȊA"N Y=5ª^(W6 B;mc0FQ*"[t;!Ҕ--թ;{fmOwJ͡kY-|k#YygȤzy{`.R+}u|k*^wև-d]kbRZ+X͋RoWPt T)`EgR¬9c%E&}&Q[âԾdA壂5Xn?Η%G|k_&!P0pk ~Ȍb@xJz!P>?/=1 ҅(J ap +HVczGƕ@EO܈ȯ~*$CO[rd?H~I>Nx yY⡗S>2O^Xu-pxE]讑UX8H..$6#|/YOGRYh˳PaBQq E'Kc7iJ+ 7f#v*7EWjb*Q w8p$XLxOy$BahɞC=dd9l: KVSNPm/,>m'D*odzAX"EA~-AyzZzх hvo=Tޥ+FM*%ױ-`b1b7 q q^j(ɆiF HQ%Wu>C #6!pKʆ܂CZ;Jn endstream endobj 244 0 obj [ 0[ 507] 3[ 226] 17[ 544] 28[ 488] 263[ 514] 272[ 416] 282[ 514] 286[ 478] 336[ 514] 346[ 514] 349[ 230] 367[ 230] 374[ 514] 381[ 513] 396[ 343] 400[ 389] 410[ 335] 415[ 557] 437[ 514] 460[ 395] 867[ 418] 882[ 306] ] endobj 245 0 obj <> stream x]j0{"E1 Bk[b?49vCL/|%P8?INҺ95F{I٠r0O7'p&)-]cg4al0%eҏ[ꠦ)p\nۛ?0'U Kg_XeF:e|.Xt9)m'u IêXy JqSY?a&s*J6mIgR9 3I'IG҅TSbC~IfKLx|[||d͹0T|Hf6xk;X_f endstream endobj 246 0 obj <> stream x| \\y;00aaIH@VKB,j4n%n5ڪuju2n]_ֺVjƆ L..}s=s=4V7^g ^d{j*[~ZpYj*W7\pBc]uM9!veX?Y׸9ׁ0_[x}РY՜[+/< h} })5*>|dz mwwx-[;F <8ikޞ%lnome:ꃔm{*iyo~`ɾΎ#nHzcP˱s@G18u Lps7k'.0+V{_{!N,=s<ɢSXU  %지)jn9YtR]3p1ZK L 襷q\IDV:y!L"~(y^e!`E(2JL 7iȸYRf ߕd/ Mג,fօ`ſ˖fyU~F͝8MI =3g&zD}~߄?9S¹Ɗhhۉ <'L}IwMMMMMMMMMMMMR% XCd.L d 0 K[a ۸_8:U:ptdL2%q:n# rrWrs{Ky't'ӣ];gV-*<*]Ȭ[0͛6nXҼq/\X|ႲҒ9Yi)dj6ZZTeAV] diKYӁ2]gKPg$}ӒI,,#U{ n]S+җU{DhYTcbc[Ś@m5ըVSdgaI-Rta.}1'|z͂0MqMmC q~n7`%"lqm HZGZ{lj?9Y}'] i[:1TWZZj$|EvD/sCSk 3z*I"[VK[Zp@nM5Ko&.OS( zHtWEثpQj[zvggt|m6Okw[%)*FzHG̕*w ml!SY &\.V\lQ+BjR$UK67O0IPeBƴM4_5AbMw g) k;]]:>,< L'DA8iEZ}ǁҘ"ܚxyj;"8I!&Sь>{AG KIm?s-D$-o _N+%k| ^ ƮAص?'1J1OysT~Hp# G%b~o \W Ď g,>[\]ccX, wXo5ב/rb,/cy /熭~,'y#sX~",cX~XXG}}ۈGYo!i|']O{]뷹ÖGGvװ}М?{{?zK|]1wh8Lc☠G aqxp`X000Üf"}ΤZD9zSNР߿ -vh}YQ\ѿFuJ[kQ~Mi\_}ɿt%W6j/+]?_WZC)ALL̀ h V9}Wtp>bx>U΋"N0:;x##{<طce_lFN-Mv.+Zj%&̟/uݓVkqF׸l_5,؞07F#g4ψFK %FKϳKH/}z0t-FK+O[QUfՂ APU+<Ʊ߿ˁ㮄oÄ2!j\. 6i]@q t[z.o;U-+eT !n%!>D (426n˦Q5nռ~FFT'&Cup |<߅IS{XB'CS_2!7ĚE&L?a`45W?NN*fubRw7M;u,srh?`%Fh6CtBtClmЋ}Xz``' Ga v!=P}셳`_φsދ׳$\8=i<Os>bp |]gf\y9\1M_qF.k|Ukq  | ,nbfɲ7M(u ܊a1GI cSmO 4Aix^7[xr\ q~z|HnnmijfaWyHnW}ƥub]3ftG3<89=ٽHnf{z3uggҷՖkXn+[u'pVnzo½xxX;83G(x[pT=ԑpᖇ%iB߇16w}xGZtB diS OJ؃p%@:M?C%,NUd۳%nAu"w)#SKBSoj⚪| TK_~1.S'&crs8,W* Or_RR\\XX_{ X-K I$JW_ N)]5+Sx`9QU-Zc1秧r]J՛O= (Jh2N,qTp]*YGW E[W˯ըxB36ua;+Z cJK6mѲSTJF3i](tS^(sG /O_3S6yڤo3||gnI:*WLVsЗe\3Or'IT7tk$جǝVbAѭJPdN%E e6NvP89{EmY=U=K\vҺwV\.YԿ6VYhT\nߦ TƢ-~ټ~4wEOաplO*V}N%46ј+lΘi:|.j[@cu6kV{r?s2sa[=n޴qF̑kFטBs!43kD)-k<#DX,fc-\Tk8#_OReg$s/ Ml8.ћh="+I FY.Sr9^d[?Ơ70faM ipsԖD_Ф 7.~?wvE26K&$_-9KWL -gX!,&N[V^r'p([g9$gpW\Z 2BDR2m&9/7/\vaMik~ջ|qX8 :u"z:_4U֗ /3dJNwCE~k_<Ή㦔z@ԖZIF{s=`fAB S{̺$jNz U9uPx UOω3}aQyĄE Xi3 dzWӢBYüecbb"5|c &+=:y$EQRX9}Ft91m^ZZčRt=6|/R*#1Mu_noBQɕZZR޶x 9Yk0Pְ"¶,-4ɸc*p&lNUXŨ-nϪ]ǝP1`_2ey 2if`vbI}^5)Fue(Rjg,tc8z4&nsa>ۧN8ҹ?X >s^NQlѪMډv<="qmQ cO-S*95^:tt9nZus|e֧Ln oiFFkɜqxBd㉻ΞcOZ~|3MfY!xY 7槩Do\={u#\gؒ1+^6kG7JgJyѢ[]6Q%7\TTzv-/jXоWO`}U%]R!}I7c 1A79|&_szx 1XsOyr\kC) /SƋw 3}g4I')ȳN؅xMoxOaO|أWhj;*':1q%[Z\W)y֖\zQɪUV/|aSZ]yV+iܢyKgf,lݻ6`wTfh.3ܝ9ߛYٜk5;Coߖ50>'2%JzzI+-ʥ%KUYR{K}쥭XYcN)cчѣzG"#gFBo߅%E)ۼB5)yDJcxեN^.iu EZWy0jjnLilE\F5]IҠU8 WE[ R: ;q)<ϒcsu@~yA'%ZGJ~@O|IYL+7({p1Kό'G+17416(ݦeȽH (Z)!fЛ=_z꒶_ǧ/MLO.껦<'GBϑo{Q.,YmZGe$ 42;?i6=BoEũguLrlCp_Ŏ"=(txgE&[Mk{,JƤ1eS,Jn,rhr]~üyѠ2:TI69p&o 7{ g=Ρ' ^KY7/gNz&?5/ v9L7>c#r#p3I bR8T6RrhM?9]1 j8=-YViqc;Hk}j:M$璐 鷸uH?qz}ehׇB?vI$KM`g>z9G 5);6JQ6aSxMuW=^*] B|2DK Ҭ RR+:aaK" aEjre aa5';Gu#v.vdC-E^IK?d6"'bm7R8Cy {waFQS>؍hL&!1ϝKsANai,ٸ4Nlɒ4K>IcQQO䱡mQI' ؈C\olA(}v^3Rxtz=g4(>נ-igΈymԏf9R<\y~I^cᕟob4n~6Za)҈lE14=qkXfkg,hvMR#5H4w%s >6OZ GNo8棖('{V F%{(e^δ/c~hZE5EwKq%:!]wtIꤾQ n)Hmx9aHsdj؋\,gkN&́"h#RH{zVW[Z-R߈j^;7H;3}zrNsrpcy33'kfa2Y֙:9=W]&MT<#kb+ĂkQ.MEп_!5=>"DH:Jޕ֏2W]i6md}+߶Q+߮Qֿj3;d}ӱ/r$+FtQ$q2A U"T؃[eD,Pߕ7 cşRۖ[oxl?9^^"l`ۇm?G(vWJWlnU9sݑ;xE@)v>p,kb;emJ YÆM rss困aIW I1l[X-Ւz*amV,͒pJ>hT&+gM&%hC-&{XҪUkҪKq(E L,܅pnX,6CVj >2jǸI .ģ0%_ K襍`d(r!dDz 7CN y. )]$>9dH^Sx匏OJjss3/!/aSF:&}Ym`b^Sn^Y+5Ni]2:̊[ijg Sla& u`bB<-Jxyh1hRaMZLkXU҇&Gvv#)))X.p9#lJ^⬽Ya_eȐđ, "Tu^Vt6+_ۜ0+-f#l!# 'xrDF/]N.4.9#Jd([c)v!C͉+7i&//hLV03$qĉ "Jd~xsscKo6x[8l 2Z a fSf0"mrBSn??+OxZQ/r "v|kt{3xN_u WJ,fq7R6dC% nʔ犊!zᎻSRm۶duɜ(;'fH?;w(Qx!&)**ue)s\'~bKpiņpg51Y\2G5>\e2%ذdVTeԩS|к(* 7Owo;yPN4NSfgO&nOOC(3):qҍ*D7ED`<>1PI8u"1;]:Vt4s]uWkCD$5#K\k|n0>7_Ne|o*l?X㳯9k|eL˘ˍ7Ϸu-SO;4_=3C|1_bX-6/EN$nxjy ʹko y%ۃy닣[!K};]U|gո{ۗ~o1CDXkVy7 {$Pś|ӿMb[`a2xQ|1T96roE3͍ZyԎ2aѣMemlsPHّ߬J%wrS/SGk)e2YůK=ݻMmjU}eJϚK;kN-eQ]Q*ժ ͯJ[Jv<"\iWaS]{ee˔-em -PvlhUƳ_NNjvrviֵuȻNb1b,S*KS{bYs*XbְnD-eHq-%3Tr);vF.%哸]thyݪ(Q60a y=FtrԞwL{.鹬W[JP޼q͍Bϲ~߾&JMo盟 7S $ݺ ;e (TEJo%*(]cHXC6͵$X+Y/q+]{'uoQ;f3Ck:;hʤEKn~z#\#\CG%(FoQzl?22p]2卑F]399QF9oFO'G]3r⏮1w5~@rkk|M6IonHڦŤuM)m`ڈYiiKVmL,8bڬiM[7)ݚ)o S^~*Ú̸=#!ct#2Vdl8q$.LKf1/gvz=8ӿ51kuV/qO|u(*$΋Ec/t\eWգUtg/Xl~b s \[ױkiA%|:j\Y3~/mj^NQ]-)Fj<՚h|*SYWn|v֛"fYZ]rqW+ky!<|JpfŶ6Նv\U'W+V6TfzZE 0<.h\#[Vˮ\hҼwq1ckqeώæ!ҷ+,a|c<|ގqaƽ~zGc1v)4K)jK^|Iw- E6]ctlXGpȘ)9Sܱ]eKe[1xU%9` 뱳 [ 3VE-}ؙ*ɥ%׵߶0uHҲ/^q1+,q:hU~?Ъ<*ZGwe%gyjvܶˢQ'mg m{WG,. +nQ,MrL#O/%J8¡ \%_͵(Zn߄U)?5mD9[ʼUʛ( zry{\SBGa 8}h#ω91eZI"(D2M\EihN7 5BH^MHFk&JaׇoL]]k+;o~J 2WDF6/zfUVFoG魼97VF"mAwn\/a "Go3ă90߲$<Oóbȃ`< Xa |*S©!*xj+0?,l ],47?ϊYV--(,8^( 8B%^/ SaGYm%֛)Yˬa̅ߚ V7<+ܸxܘhުm/V?c>.6rZEV3E{V //[i=^V}-gH\ՓX= X݀X]Xj:VoMXxq˓7cq 0V?H˃͓u.va{5fRcǘ!y[?w*>hWog,[sxq\Y/,=tF/zF=~Km? uxrU*u,y,a!`1,bI쁽Jk(P8pXI?TQ+~ЫYhM>E 98cBgnjUp3?\',efAB9T!*NoN'3b%}~ɖXW:&~ [li14ȀY{RlO|,yFm~7 JXojܯ~ >8 GO NguĆ&64hb1B+I1;\]r$ƮhK"or÷mE/4 L?'3d~2OfL?駶J5iMdZD5iMdQ cdL 4濈0s2)wd5~O?Y'kd5~Ə dGQ͏Z U'MD7&DTj  E?Q E?QE1c}F,1%Oe~\*n0gOWBaBc?c?c?c?c?c?c?c?c?c?Svc2_Kjaaaaa"3_}W|1_}t {@hss9z͜K؃؃wfvƱƱƱƱƱƱƱƱƱƱƱ1}C<,ef2Jo>88888扏}2}^G~)_JWar0*騤>|?LOKKKD1'bEŊ?C?F2VAbuǨu}w\4A<ʅ`f7 izCPWOп6t<hv p 9=7?11\D!dH,KĒ!dH,KĒ!dH,-FK'--iMhZF2Ѵe4-iMI%N1[g%~VV܊i{y2<gsDKLTLTLTLTLTLTLTLTLTLTLTLTLT9GCd!yuz[jf,RE ώSu5$O'Y*3U0Ϧ;:JfUzK'7?7n`  w]p7$=0p/Ca p?Q0a>3g!<,|;,exë?` +a_o/x ` )k]xއu6>GmvW vC1쁽z-3RLeOrX+`)S [3X7,_ >i)EdXZX~'":U\0jN?VaZws-ir- 80? 6!"m?b 8 ݠ;=z@99g#lyF^+fcܱGA4=tv|lg{p 3t8 ݠ;콡~!CўsZfu}>s=xw`=lm;`'@,~)8| Pg\kEedZHF6 v8<}濱00}*?<>Do+iܦ7:Lo1X<__xSXtQ_C)2AB9T!*#*8 A5OoL8fZz^mZW30vu^#|;,exëR #2DEFcѐ*{^I+M$Ȁ Q!eJ_I+%WWWc+<|{1U0 T*Sc`LTsU5YT;8KI%#Yx;xV0"9yAѳ(zU2JFW*]%Di7JQڍnv(Fi7JQڍnv(Fi7JQڍnv(Fi7JQڍnvTJ"PI*@%$DLp?QpE1QpGiڼ'}˯zYJFkOOn& DY*Fb*FbD4FH"ID#hhhhhhhhhhhhhhhh$$D4FH"ID#h5u}o"{ݘ';%.^bp_ۗ}߽w/{݋^e ^e ^e ^e ^I*RGɿEK{}Lԏ3cȔn鐩򶝵eccy/al]a}P_C)2ABo|p_?$5~Ѫ5w qOVC|_72F{#cod썌72F{#cod썌72F{#cod썌72F{#cod썌78.&»Z#=Z/Q!+y5Π8C]/uf\+BkEyA3xXxXxXxXxXxXxXxXxXxXxXxXxXxXxXxXxX(nt)FbSm?/ chw mt+Fbt+Fbt+ƫ****************aCsx/ /^,f;Q[w+n/SGVي?[g+l%fL!q}EU)Vlb7qw@XLS_.墍5/k]xއu6>c | a |V@ 㚭WkQ ӫY1ޔisҹ0_/53Ͱ>a+xH߁ڳxȴߔ& hvj|B:czZpҢUF,4l"?\ljL4-svʅg y.aYRTGE?*Ʌ2Ջ>#yؑGY# |d,>GY# |d,TA<[PQ*Wr(rIߴB` V` Va#ODE/*zQя~TGTATATATATATATATATATATATATPIC% 4TPIC% 4TPIC% 4TPIC% 4TG%?*QɏJ~TE%/*yQɋJ^TE%/*yQɋJyS>S>S>S>S>S>So='ķz[O|>S>S>S>S>S>S>S>S>S>S>S#_yiٷV]C5bckX#1ֈF5bckX#1ֈF5bckX#1ֈF5bc 5|QG 5|QG 5|QG 5|QG 5|QG 5|QmYdy3l1^$WS+Y?Q< G(|ϣyn8ϰmBY^C_CclOE ^o38ɓWƝ0sw?9 c1Fq<'MOcixŘۡ~5P4fi<14fld|/~ˇ_>|/~ˇ_>|/~ˇ_>]@%.֝WYrCs ں/K5nH:]q?K+R c[netF`݋qA@ @p1}t^yg!9/4` X9V΀3` L(rT !Q5$DՐUCjHT !Q5$DՐUCjHT !Q5$DՐUCefO=o8z^nI-ڮVv8 8IaK?Nٮ}>oSWdO <,RߠܗqK2,mWⷩUdq zj_^[REnDvU!z3q ªa8ChL|~.yu;. R,[5jd~εXȇb2(d'F\'UBK<\p5o;O01L}ؙYu@_h>ˢXͬϚs5j5W*Vg<+,VzYo;m`˭bU,W`U,e,X.rXnmc\?\ ,W`~gU6vVbXj;Kmg,B[Yh+ Y(ByʳP*Bg,P>:. |/|ɋY?XfES"7 oE֛qŕA~_#O'>#LJEIsia?S=_/ר@/`_\='Rd$%=f=o۠6HSӅ^ -.XGC-5i-4kK+-Zi1 ZiJ6 [ _׽f7sys7j~KeX!ަWZa]"K.%rDN5](j(bFD̈1]"eD.b{w)Nj"~d< {]iͿ!B$XZv Xy+aIXJ}]^j j'vN l) k_?m)vU:dAN;Y{]N;YV/Yecyj'a=,j{x` wO2U%d;|Ue*+9/9eQ0'xn?Vf. Og.]70;NޓizQ^Ķ.GY,V~h^RɋX(fGoTo}["v(婂>O^ꓗ>yO^yOg*7̯Wx!<(zGEsRWX-ayX(\φvQtg*'w:a=ݩnlFlfFWRy~w`ڊ!a{^kTZUVYJoYj{x/s .@ 1aF<α2S?ȹ7˹?Y:WgY)ȿv#87x>.u[b\[k/YYWC'+cq W?揿_ ae4^P^īaU]isDڜd+ hDSthY4{~kmXrqSy}ȇ-ת=VC؆rrQdU{d7fNrN)8t3q60#s.>EH->'I| |9^ii|%|G\Wί F+њ5&u'~2Ymyu3|yֵ1+cumlpإ m=S0-(?̈InI^96r5hEݫjfߖ^_[VVvջҪ]gj]eg[V}V5VVٽVJ+߭sd)r"#{AlH*n\(w[d}YQ5P{75LkEܶ,r:37jk)MfQ^7QurGfaH  ٠B>aX=*dZVYE*dC{o]4UEhN{TղAhQ1ZŪbhm{'$wRN1N.rq(k_)ztxB|-R1T\,ݟ*JxG+,ңJ#+9S5hR e Xt'vBQTC+%eɉ)Y=+gϩ'/kge8ezY^,m2r,QٳQ,FygwZyWZeFYQl5eFh)eFٱGeV/+eeVٯ^Ze6Mk岲ZVVjYY^Ve6,+eez٬^bX'ߒd&}7ߒZdEied&IFiF^mF٤EhF^m1x-5eF٢Qh-eF٢^)2EV2EVhFIh!d&hȰpt9 n[}n11 +%~*{>_` X5|2OfZ12 *[|2Ӫ*V|_dl@k{+g,'lF/QNE^bhhEzќ_2%g{ll#<&vN3vzͬw 匼՛Y ]ݰհ QQ ͰMŰQul; ]Oˆzk۰֨zk[v譑-b@;b@;ܮv=ŀw}ޮF{{T#O̳fFz,-sN+gʽOK^f/yz|etfrgK-F㜕f_(ҿQE[Cr6, kڀ5,g QZkwX`mtSҲ[=5yr=Kb+wc O,EXEK?%hcɭư::XӃmUVʢXt1.b6\dumm":8wې ޘ2-7d|C3dH@1|#tB$=j7ڍv# >ҍt#4K-tK3dJYVe/{Wo_QG퀋vE;ph\.C/G; CP ClG>nSzͲN(vbE;XNh'V+ډĊvbE(iNZcNeNUXbh>eQOSXS/}nۧ;&I`.=2b.#ҳg6GcV"zl5;oy)NwJ?).JՎQ]rd'|ҩ!iȝN}iMmSC?ď(N gH?CQ FˤqH4UoaoE!ͧt#nnZlˍ|7|پپs2,iXOzӰ4a=Uv~n>}\;,֚ZdDF4jj("XR}AÚkGo=h)lV6akg#a^nv00AQ>l!s8E0O(/;EH/;xۍ:BSk)#ѷ#ѷwD? ߏ~1?6bǣ]h7`{+N8 ćp2N8 p6p>.Gq!.B->q|ħi|%.e⳪ýUBlq^@?0 pou&:z"&a2s6js6js6#p$V߉o:;x6jh_t?p A|2|_%|AD_ŷ|;_/GM*p3naxJ4?%OsCCp~_~ A<Ǽ8~BølFouB ؠ *8 <?hΕ4\ps/r拜"gGOo*gavxmBct?~ /<Xa٥Fv]jdFhņ2ڎa@;+,' 剅tohLѦ؂1Ala;Qzo !,ޞ44V} W`*,}ʪko{;>,S byxqޟ:.r|mXvt` Z[YeUn-枩Jn\&JT$`"d*t1>]O_+Ư׊kx3^O4q>MO~Ml+0so"l<0ͣxtY<:+yu&ՙ:WgVbſc>X5+X5+~'$"BV X!+?+x3xكMJ"k0=uI-u)헺>ܟ!M3JipU\|u \|Maeܨ5QM!7|qqKohrV܆G3c܁4b\1-MJFX"X6["}<3}Q?,L#/L[-*Rx/8gwPAi|s.wL;ߓ;;i4.<UWe)OI >W,aalfѤSUbj>~?d }~-/w[5w[5YUjė3Y&U18x)0j6j>TqҖqUK/Ų83p[X,C}4fЈw5|Zç5|Zç5|Zç5|Zç5|Zç5|Zӎt ؀؄lF/&MX7 ,R,ÛXx +6A=VAЈwфȢkЊbڰKG&~1o`=Q Qo( |J %DQ6`Y'2Y0'$|z<T@ Sy* O䩀<2 r 9#q7_=|Q6tl:G6#ΑMȤSeҩ2TtL:U&MdD&MdD&MdD&MdD&MdDͩ957ܜSssjnNͩ957'fd݌ڛW{jo^ͫy7޼ڛW{jo^ͫyzL=Wmvދҿ c؊!l0[V-ϖge2t}>]F.geѳ2zVFY=+geѳ2zVFY=+geѳ2zVFY=+ge,MM^Gu4yM^Gu4yM^GUTc $A&u~ج"dRplppԷp}[uEuEu%/!BBܠBBe{WL87žšE^{ UMHoo"Q-"Q-"Q-"Q-"Q-"FhSyj4O<5FhSyj4~8 1 ca 4UjRgRgR%Q%Q%Q%Q%Q%QBiEva7`bKMWfpYn.EsuΩxS :GUT*ߌq#0UL(\euL@GeLswNL*K~N)t3q>v|/p0ڏBϩSUԄJQ9*=GSig3T*zG3cnS}oS}稾sTݩnVVWTS*ĸ`*jTJU*qNe##U}qKiW[]0fW݂[q~A =sty?Q:OWjX@BciHHޟO6FV7 5@u㯎jj~6|<Jϯ|kX%*喚>!JZP+j%Cd V2JZP+j%Cd V2JZP+j%Cd V2JZP+j%Cd P+ P+ P+ P+ P+ P+ P+ P+ P+ P+ P+ P+ P+ P+ P+ Vj%VM+>oDS+]Qqmt{u+)Tŷ+RN]_OWNjWeq=7'q_tXMP%ZZvnzYoSv>}6Qo" WؖzK/běBQg0(~cKxUx2n46;)S:5zkMXB1`/xXqؘKԴq7EDΩDUzCu=\5XZ2C{*Ԓpqjy,_dT%fϊ&{9Ncfլr޾r{Z}fw}K8)JE8T L@ &bR&6? oFwa6wg7܃__hQXϏkqmd}8`#p$8803C[ŏqO0 ?] ]~ AY)*Kx/p<l\ ʋ mw:OT.s&y%}^hU"Ntʍ=!UCq>cCWq8'` noV̈́XU ^oV/zzX[}:>rϳ@k0. _5ao5O Xb*4 E3֠a-֡ юt ؀؄lF//N7tOWx!< o` br[X hĻhjdь5hEkmXvtגm`EiyiY47{-a4qlMFLaW4RՇ9ѤxQt^r`!~Cu^MWE_`/دSy{q6:]UB}ugJ}ZKd=-Ssx6nPJLUQEQ-7ڍ.e%~NW?. %ErgO(l 9Q:k>b䇸70+C}|9/Juqxr0ٍV4%J8T L@ &F? Ԣ&ZZZZZZZZZZZZ{Z{Z{Z{Z{Z{ZZ{Z&c)uQSYįCNS@[d>l}boEct\Żi,fSWGW(a[͡+~(p0 *EgK{xoxh=8)G+]e߯)\p6XV_ޚ$4yfTug\Iao7fyAt!ojNѝe{)WY7֬-?QJO=1~qU-aOyT8<&zt7ֈ=zx꽭-(ٻawcA1ZcjL ,(K{ړ)g9/m0w6k̻]ɘ>~MD|Igޟ쉝{(}jo73pn~SBOy +}O:h~ZoAJ,zjFYАF螑0쉆M>l=Ǫ!G)ώ63⢻;ygwiKo4{cTcT֨zxR Zӝ;^'o*51ooW]q0Bb![U<o ]ZHia![B[ˆ#hOgȹҘsuw&>ޑqΏwt@=QEa }P-=R[G~Gqx׵U>8)SzKmk\)w7t i|zr64񥼵)}Gs'E_UuWtov%-e 3H$*Hx9 L"d$ %,ݿy*LwW߫zS: +x߃e5krcԫQ/,seq.‘6: "-E~ |.O8_BV|> 9F8RR]cqINI/4t@) >P!\èG!#zږ F sWHn:GkoY{cߎ^Zd{{"[؁42 l ТUͱ%lh]228?`%p%ҝK$J4೬6\ !1.4{(d4j9G]`L&\~!lo)`۷m p X~lzM5&#dJ# ^n>Y"FL"5^TU!@OS[Xc6LSm*h-i7h#mV-$Š4`#HXO֛~dX?ZV'i {LثCl80=F1gSBǫKX ^ax}^yV7-XEފbxގe=;+X5ލwg5x/ދx?Vײz~=[Y~5X+u®oص>ge|Ȇm|'(GQ6kA#`%"lD&xϾDHEW(;eE9 LQYd٢6OQ_4`E#є-lh/:UJѝ=5lY~w{nqA1T c81O1ILbtvT,9?cq\'u 9yӈ7wr-'7ywg3|L:|󽳙?ls4ƹq|&n!7q7O->_??>w?tc1>Ւ9RHKW|T2/2Ed^i=Y}UoޫC6ܤ7ܥq$*90Ÿw]So#<N9#ܴ-ĦvzʹyދcH+OO_4I9c#=ލ.'p>_p_}b[<6_s-#Y=vLck:4p Fs~mXˍ)9Zv`vaG W3ocC0p&uB3+هy>%E5G}ݡi<-#utgWsڳf8XGO?JIě[`1g-{Qzn}#Wcп`=Ka\}>@+G)tMix%mvv.;ӝ]M-w+#HŠF|'=nliz(?J[34`liHi-+@9:PM#d7ɯ4_ΒYnE*hhzcw:]Wzcwcw6cwcwNcwcwq]CΤb!cwxcwcwD5NgŒe ^zy$K^q/ Jye^y"ѫUfxUvQv'`XS ؽalvaie2an~_%ط6`3mۀ4[mll Fc6`?ۀ5;`lv~v~uU\><8)7smap$UmHh>ړI=}ZUض0Zld|5-8ZC*E[i/>i?Be0t~rt-2ѶE "}"}ț)߂vvYr %|-xJ^ZԶ^l{-bkAĝ r( mW! REmEю{SyZsMWm8bZg3qgMgsJ8C47rmm/n[qTHuT):N.CWHn\"'eOz!mo-3KA}&}:*W7PQ9u#zQE1ܯA q5D=RFOSAzO13ܗP}U k5Cgzj$jz O |FH5F||ƫМ&B2I}d\/׸2Sշ 5dZ-PPZz7mA%NdڏTZRh:BeկWxT:kgXyyL {RIORH6P` Rm "3EI I4C籋4|׀ qiEé 48(Kˀν+`!IC-8bq0`ųxYO ncw ݅I$p3LܢРdآgQ2XzL8X8%<"L %)Y+! 78X` qV@}(dQ/բ^YE/mړ覀kD\hUOhBUh4Xd,d,Xvz-[yהŵP ׆!<\s-)zڣ7kO"EgԳ\Sׄŵ!H )qƽ^ Hj1Nn"n@a|UcXhRO;aNf n0NYj ԏ )`f d-d-٢[an)R-Equ %Y+l1.5q X&,E<4) ggA27<9 1|iIe ݊P?hGHD3eQrۍv<\|ϖZio]oPi3BǤߞ Z磦K'Q̲mkTdH-z6U{[U`e i)bC҃Q˻`zbCXAI2#M@7 ^O-6VV蘓6 xnbM\> .ZNF{lƺ>ui\\wN~CWfiz*UYNϙbZvgzf^F)6%ڗ 7ҏ(e\^Tz;FT˱lcڏ8΋ݞrqy}7mm1f[雾Q_gdy2̙X;Aƹg:S1Ϙ+y}ǣES}|^deqvU[ ݡk6dc`c+0.D ?}6): w_ɽz6:;b݇59ag Џg~+%|=ZE~9pr97:K.6y.ʋp=/jD*3ɱ_A\GY9iarf->H2yXY0=vh/yPȼu[wl;r;W&]Hϡ”gfJgfЂt 9k1ˆrwF|ɬзHΒ{Ole}Gq7gV~ʼ>磞ÀLӳ1bgmz~wk=i_ej^xJ΋.aG[w!A 1@;g|y527/~owxaM(g g hb hk b o~aq"n2@m bA "2A#xx6zh0hGzddIEVY:y2be%,VfX̰XYXeHp3Uaϳ* d1JCӁ$MΠ&l&I5,6jyZ[9&Z@Xi6",gEa+Zf6;1| TYM[%¯E-[;oq"E- (\Ңpi!p "ʉ"@YD.D"p!l t.mѹE2vO#ҧ]Ȯil!zv^38/8C3yWt&%IaNEsiМr Q]7MJ)]Gz ,7w\`H[!n#nwpwPA3PČxw0$rAY#JIfl@YՔ,ZIFa% qG:ҥ?ғ>%@gxO #J"y,@YPNL"!e2r., #:Q8ҖiH[Z~YYdyY9W6Cf ,+#L * K_C֠$YSքE-k/Ⱥȿe}@6NCiFEPV3 Ke h-C+ٖ\Nvf'ى,;=d/޲^ވo7[or0Ցw˿S]y|%Q=O0P!|| $yJ>O#g9>/Ѣ(K)ftQ.SeoB>R-6Uw%G c/?HTb$ x l9rU12KRȗɕePz*,EUMnCvyPQ2(XN1LU\JSUFUʠJ/IMT-Uj:$uU}!tF8X5j<[V8ZjZ3fef!B0`  3 O?1`T0 a3!U1̀|X~0o7 :` H9X4gy~} WRo)ez˼ec` !Yٵ^⻼](eAup^&AI &L!]C]FU'zPPPOE-!T!4 4q x¯_%~-=:#@2?xxgxIE.BqPp֐Pj8HFT鏤[[Mww?Ei$c珃GGBOO3ps2 )u~p-3TŸlh>#{ >RV+WAgu^E>gYo@|yn7,1̉B`N;I =EA~? !?Ne} ӱxU6H8jIrB ߢV1Ń2AYri^Qj0;Cii lgOP ${dOP ${BɞPB' /Hߎs( CCCP&9I`C!P&9$#PP 0 C!P&9$BC9IɡLr(Ed_= 3g? ߂\+doZߑ}˾+.|_i4l;'HLsd  v~!!.?#~5{&{[kaD`?vQq/䀛?;hQbHQHt+!< 䄔28))k |6䳰<x !'CN'BRKVCTRR 55z .B K">F7Pnp0p$t8:  q֌$ka5Q5Q50ɚqDA$fxP! CoC&Q9ɩ!!Q"sVTD!AQBlF )E$y'`Id(VC3V,l-"X!)Ic$NHW$+as\$dHJV+24Wd*3$&$I lO2g9IQx8IE1qƓHXI-)d?I$ORHdE3$gqsP$|(O)J($+JɊ(40FI$QInŰb = qQ E?V"y%$ *(P^VñU*qDcIc%XI"9VI ܎ʃ:"4 ' u?J<@CQ8h4 -V@@-.="R4B540P$(J&#5gl |D)Nj[9@:=A /= h4|P78:́A %*h`M<|.ΐsXvt΃@awh 4spli(@KpQ3sbje̵^`.κq[I+]5 MC/pˮZajᆫn]mX}?ڮ5̺$1qZ}Wk 7eB(z%95Qno5m(:16pXdr PeRCQ [ŨZ1h!tݵcU;5 7鄸|֘{rj/sX &TFKsa.a\ 4͕J1վxY~z?'U{fH˗b&۾D|kq od1jxls7z9rsjAYΏkC;PXԸӌyyO+IT1u<do͋`t-`\Xt[0eR-VRw e"?-l Wsb.y*\>?`:CT)EQu&jq?0F˯z]#0At$O8RJGPyxQNWD('9jr״+ ѣt#4pqF'=R ixA^N&n8.>(/:~Q)^֭8cBcđ~c1 8BWkF%p֨^7\Mݣt+J>IZlo1:ūxO٩O);^L\1vn}8[{MxFk| {(7#C,^=<+{ySQ`qhś>}|*08RKĵS㊸0ނrqXfVwq=zqj&=җOM2&VU'OMi$,o5xLI؎*'^5%˵#:Mpf=w۔Aʋ9=':g&w`yS!T0LǀqS{ԤI{>ہ7"ϴIarQsS7Lv$[VL{-Ͻ\џv36L@\(ҟ!u"pwM{AqYE2044MúpnrK1 SM;Ztǩ2el0д䎫DUiXNx̴! JB,O괐 JTgdQO꼐[Oꢐ)Ϊ. 9A!_\S KE<"X.yz2螮Y0˘7>2፮Lyv{[fIy, ޔTgXٖUoV}ZֽP_b(S ']_kk,we0:h[Yaԃ^[yjI⭬ BpؾHeoSl ?ݔ<Ӕ PSl|S&|Ŧ०|&뇛Jf8_)g&&gW]Ԥ^]jpkkmino{;5.o7>osd;=>MhýCpvxG }wppه5QMuMlSxSv&Mr@;\s )qϻIk .9=Mfӕ6dfCtUo|E[i6"+ӄ7Z\iJn+#w-Rsi-0ʷhnFtPmq3&q-Poc7mH x[aeU[#`+FVHXBôf4gk;NkMG4֬r6Ʊװ-_/ Lm ،(1nu-y- ~I-i~-iɄ-9Ps%ogOA4R*gk[*2XjZ>kQOBFۢҶĊ-y_ DʲgOt/g[ً- ӵ쥖~;r-#PvhbZgؙY<;rݿ./"PjY+鐘]jYW崊E8TNA8aK3 k-:z\:8STqg7Dvx8\ bv9=p<>ǘ;.@ :Dw9 zub̎~˄#u\!JxwNBc,w9 q"D׹]q^u.9\rpZŭV7ux܅%{b5xDxqY3b-h;b-nUvZm掵fv^sE=9Ggm /:am *ǭCum!:6F8Aɩ 6mlY q鶅D\RCFjCum!˺Lj$}6݆\F>p'i(B{Pf}|Q 'la-5A Qb#f6m-ɗഥҔ[ wDז7tD'=FC( =VJ|9 ݶr_k;+j8g;+mն\i }60`| C6xèMU5|bUäҧz֦m}چ9Ұhs4.< l>ÆmհemصM.4٦|Z6}mmׯ-hm$ۦoDj]fjmk<7ﺶP绩-kQnkOcIۧxZ '4V5ǹ4͉_o**}R\CwsJ@ߨmNo_lýL#=NmQG#hg$ޡ)4BCG~BI@?cOb-(6G?Bqa0z:L%v.}-Gaq8y@|8p. {S$0tGP%:ZiB_D'?.Egȇ~~fѯPRwcEPɔ ?H=NXQ):KS7PB|зEY$L5IDI/R)Q(+R^ɐdꐌIޢNKMoTRJnH~F!YR$Yꑼ-yQi.?8_22j9̤Q M9RoP02e)g>K3542ϸ?QKy~3Lg s5fY Fufnf6 ١[SS?>OM~)- ;ҧW 4TDOJ7Mi7H.~=H!(OAK@: JJ)AL'T!A:|Q ~'J@9oР0P (%q+΢iVmq\xp"B/'W^e/a/ϼG1|<ħ:- -(DC'>EE7o"-7L3 KC'O B^@P9y"TA #ςߦ߾} 3 bPTOSt> L|_ɟ&5㍼{Nj=47:4ď@Q*LR19п`: OAxsy Q)C6dG#LOVbWz=ހ)eP?z}gL -E߁)}k0%ZD _”~ GoaJCwџh(L*zLQ.y;A/QRϢO7 O,G/`UD}RWZ}<]J{Q:TF>M) *Z(ԇCځ>G}:>OuS *OjjGI{HEMS?DjߩGGj zdpO˚dVd ͙dLD+"3yBk˾loȾڮ]p6J{P1,Ȧll[ɞ`@5c6kedslC(;N{]dW[{ɸ0".KR . ;Ɲj9 w8s"NsgE7s7M4s ʭs&/Cy> 6PհKbih0&iGIk. К[pQ. \LZs %Kp?6]JYx2Қ˩9h<5^}YeT)Ⱦ-6~'7\ $sQt!(hn4 uGt\Y\6LW &LW K7eƩ2Ӭntӽ+nt3c%2"x'u5Ӵ[7&4A[cݶiGwtxW!37w4nI Q gÅn: \ͽ+7%Ds7hI+q_x96AHdnbӄ}XlzWlAd\B[$U eX%[[!T~ NU}R j,Ejq#E9'qӖ? Ma^/t۶dK{2޵m]z^=ާ{4"~`]٫tMfgp=mEvYXaׄ[U02]ima鎰ޞ3=asL?c4_$%>,ļpoO_|Wr>?f^}yN9:i^pnk͛KO{$ Ѓ{+SЍ MQX[lJO<טy|" /ZBq=>6g O[pʟ~?oI/Z_ᾝ3w~Вy-9%7?a)炟ohR[ *~ɢW-@GU^힙9g~ 1Ј1S(b)@Μ LpfB)ҔR Saӈb ?SJb@JH1ӈ|y'v}uj}~>3烾g.#y= b?{*?yn B|]K|={"{m5j$^}\}%׶3c_=,eo [ cسx?Db0{,_|C xoe3~ed|h5GoaL[FԖ|f}SU1j߬`onp 90[#'/X p.- #.DD"<[B)#^H-:U$۠+ƚ 6D>śomWl~6}kÑx U!W⹯A_Z#yz;gC>n}e|%{cmy}ɑ!֞&_ݳ{ *Z4k^oi GCF9˟ZZ8(3R-JE0h:j iP94,RfBNuS]8]8O   E }EK EŅ V.)ZLK~YnG(%lE/ѯHm7s0(RÈڃmq=Vh#;k۞g}̵ \4Ң*ȸnon!16Z,BHImVѠ͸j_qXW~u"s1(|GBoPL5q.jW$k_S(]R(o = L;9/4ӟncB^#?-u\hQ$9&jh?'-(3B%oz*{CDX??6vSvWKB8ׇNBgs͡ 1!ORMj|~{? 0_'ñ3x>'/ذ=H d? !:uK σ Ë@^xC@o W"[p]a,,  \օ6O6B.rn2|>%|sjW;W{­m9D(d .2,ll;=ʿQ.IWn6I^r*gsYOxy̩ tyy]7ѺM6B`=E;:Mf'M=OgN9úOe }NߠoughQokΰHc~P?GGeWfQة| _C8IݒZ<ރo}M[&o}&o&:D7d|o)ICԆh >oh7Eje1|ѱ2]|}O/Oh:N |/et2f7=/e|>oS)ߖI3e)|Ζ?rZy4{ɍ$$E7}U!h#QX-]ˤ6Ejnͧh{:V֠5jMZv)9ܴ%ZR[mkUZy71x?{?} _"Oy|w!A> _qyȓz/&b?!/('bޤv< p7^[*އC0^{ ޗVkhIk|/V?>hi)W+Oh Ҋ&[ ZX!XšmS4L2EF\bW~qǦ_iڹR6vlڅ*ithu9.j{964gl~ Ek0311Mt{soοiĺFӬuؼwy~%uld-9.0%wlTO-/7M uiۭq6ѼZU g޼94Hnڱ9;SOHs7g"ҜEҶFZ6$" D+qNmv͹۹[䬄mv=rAG{`߰D*%{gxsZzߤcvzf~kWSd#+ ,L_IHzk)uq+0T_+z\m4\xի5VEZgDWMM=Ǥ~,7zެ_sI.CYnoZW?WٕFkj+_^@]5Fp ɯwqQ>܇I4<帏OϺS4/87kik]It=zw[=+I?M@ٽI184U(-,yƒ~z2=S<=Yw^6nkYDjҾ 9$ S bēJzEjHߪy.FyoˁcC\Hl]oko*Mv距$;A"'{.tDI>n@;w}]>]ށ:r}>'ϖ{iF&^k6ިkJ|žxc~ɦȞ+i6DMF>| Z2%h&{dNluLȟ"_Qy77(l c/ѯyCna"yɶ>Tv7U"NhlS$!+oG՝PZڱkvԱhڬ_ޭWrͺ]}ųI7آWNr{"zvk{Heĕ]ė]ĝb6}9XT窼"{!~V܌A ;u컍xm?Dt{"3~茰M㰟v:/]C.r $xD#;?1(h1_Dsa̓cÑG5 Hnv/(gط ywP Xfc15:acT#:>tPqP=:Au)ac~E׳?8rP =q;pP-MPvW!978~'4GTdl竑s@d">{=_fDۺ_f}1Us$E% LB4htxIDD3tyD-&ZFh : D*m!!A aDDΊw%+X*Q$ED]z}Dvڮ#QDc1GeM!N4hh7((/$ZBTLh-Q)Fr*jZ]D{ꈎk};D Z+khwDJdyB%7QN~xM"J&Fj?Eo.ieD9D3r(@n"AKt;VژUUUU 7j:Uu:!1)9*VVIԒajS3TUQgkkP@ EԖˉV%zLjP7[nu?zL=QϩjznGmX{=>>؞bimodwاg}}}}}}}}}}k;{gWW#Α<~K-Z&5O?O61t,t,q;V::J*Gֱ˱Q8wv4Чӿ ; 'C C,C }l-$c+-^mتmoKOضޑ&Iٶ:N0IO=l=KKW?c߮l}GQGQ}E}Q܎g`,9!O[Em)&Q&Q&IiBeeI–*9f\$MUJ}D1rL(Ui;ŅѕUj]JkC0ooXla[Xm?mw8^U:a{SkmmmImmKz{=`)Rc֧ (;w?\3G(!σW(oo<;>D8_^? g*OR@>0]yp-t^~YFJ xŏo!"~7} & Lc4 p'͉$> ߀~2=Q&3g*1[woe)O#lɗ#]T'鼐ZR`'g󁫁w7pih> ~Ey&"+&ƨZc~WDhnK,]!Fcݙ7XDoƳ0Ea: H䱔? $`%tHRc:8x?p5+@1{?g˻:?ó1x!G e8xlލտ FãA 1l}Gzu0Ά(»o`t&1c\<H I@0G垐WH`?mG\!n]$ y<,r<,r<E%ۯiei6 އ|Xފc󖮐+c?<~}!HB5A"݀ew3qwmjD`""b8 ցA1a35ozYSjQ$u)"H>((xY]^cb:%b_C\tQD]$,6kjy30"4}?rld "#1 :6"X؏»~|Vyia4%A""1A$C񸛏,, bldBa1ч^GdBrD4 [T.rTH#k=`w^9QGnwm>@gc8o#2i!Ї2cU8ٱF( }P3c]MZ_F5;dX6rug(5ፅocy29AFKL4 X>86Mpҕ$_ˏaaQp5K)Q]?}[>ŻZ^!OqjTPs&(jW¯Bە\a5oE_؎<?/}@Wns bDS,N~DzP@p6pth>{-ʻup'dтY:T""]q?'n%N\S2DB"V@>w4{~z w\:M%x>lX O HdT?;QWCg9_C}8ꆼ:y8_Sn~جE]6| \AscNhє_r+{KSO1""-DNC^_Ú$@O퀝o2c-x'ljy߅,ue!W Y|Īs6z gO7Z[f~Ws|֮C_M宼G1EN~H0o)xB̏ iOX8=;ETc[*wݫعysxe#G}KہN¹{g ?Cg_\q6~rGdwlK5Ne<) >s^z;M]2vRy=a|%bed X,?uy>N)?9k'{QNoH BgdI?1ʽmibNLw9 oP.FQ't-B^;ó+W.lc|#dg|fOA'\ ,g: KT7r[~(y܇$ŖO kBM4itܟ{,oYyN }>GXn L©Or]ی =O"όu >8SEmi q2-uHRbV{R1 0&JƖc1?y30c+F;NobQ7gX 2y^Qa|IpaR|wLdx} 2k :F0<o b{*`9|>QZ5Ҋ#.Bt~,6A,hi_Cg!ybd/W1۫q>@6{ً3c,Qa'}(E{n^ܘ> |NMM/ Hy{w~1vM};cԍcx$cq 1Ĕe8Xy6?wgf>,f-$}CalYg9{I][BBPInLH$I%TtC*I.~Cwޟ/}~~zss1Ͳ1Sǯƛڕ[zr,o 9cۣBB=-ZDɮgwȨ"DUZZY`د ꌘ(56ЯNvk~è0և ЯH'b;B|~ ?"-^Z̆0fcb}nH%###95ֈ*Ȯaw/qWW|\˦!Foº\u`, HqdVb^6ˑ3u=b@_ÑȫD>Bͯf7a_2CnC*#`Ϡʰ6 vgZ"o˃a770_.k > ~k*"l} Kh%]L:HG;|drpnPǧի>٬#y&j%]#45Fm2r y{YT%s;bnv_s3 ' dىlCk 5v`2 ~Zs 25PT!=B5.C/jD,x~LL|'j~y*?Fopj=[0[ Da3d "5gV(g{5֐.2C x{@1BlO_>l)F~bĠf(lEhæah',+Z rw`yI8rĥG <lpъh'h] sg{q6cvXք8Wa<;мo=ѫ,C_Bo!&K ? V@wcd4ϑ4 7iL4xzI #&s(ZK|Udp)!h[ЊHtx@95 m?8G¾ < ?,r/s 'æ9<| &A_ g]YWъ5boC8buD_֞E h*s\c+{2,D:W@?C=g2[Zhh]MZ`}-n\?c|ݩ )32"/PPG3dZ1/\G""8za uZWC^!qF X/5!*8U$4[OЗ[Ooз¦ihMz \B*h @8n Fk/ںVHG_̾3\w=?B ("`!KFk ɰi_Ih}220ϋZ~#{?~n6b"4 ߄7khzU@?>{@~0rGqjr ̄X ,{.8|69]@DADOBc_CWd AĚb#Û8֣8{ d Zqtd#E&z!O?3ZgA ہEAQmB bؘ} #Ba ksʈzn P R mf2;y "&?A=w!PBhaϨ\אgio"W 51~{<Bl!\D=EF#N@?݅p6 ;:[ ʰO47 l𐅣wlּbǡbW6~p ~@sRA}qdl΂C'E*<iȉŴRФqЇwY׀e r67;Y֝;)wr0zhNB͡Ͱɏ^UhE!gux( ׆\!ȏB~:vuB{ 62{F\CnfB oVCۂ^ 6 ž`3CPa:ሧ`3:O8`fSFk֚݇%ǝ| h8ya-@.u,||{àY'hA0πӘǮR|G3fxh/`oCsfA$m/эM~`%~gymsj=$lҐcL5p&C_ o䕉+g>1aG}g" g l^ w4kFWt)Y2B 'Ọ~-q}d&;aF yLhf_Y0r!NcyFq~8y4}A桉87O_y򫐛>#L5%C36b蒉C@rs!p6|omi6WF6&oCV0W- BBZ1@M~2|of+h`x6rr|yZ 5ǫo:ʙ|/\,47G~Z^^3 9oAoBpI9g14uz1&JE {<5(1mZB}횔 ])ss)bSeE1MNץ~FCi 4%ᒤ4*TS]"=otqz4^olu=+CITnG zS* /I4U[]mڴV%h6ިe Uۨ)ԉSEz4Q@/WJP92:Ԑ{MCKJԭ%(BTԌ6ԙL !4FxLGQ*EŨkR#jN--u- =M"MW{T܃GLp^nC3p) 63+`жHD8x3Xl{LG0=Noԭ \ q7; ;u&)`)g3ު7P}TJRT?*RU*%jRi* AjQC*(E=3*FQtzV=K%X5JsT 5&E"QH}Dc*>QP*j1UR_fT-[TJjZAU*5j USz6TCmVڪR-MmjIj7Q{^~UR=꫃ 5PaMQG::A)u3 5Q9C]P.ҝ겺LulM-5uRqy|S+Կ{PZ{uQOKն_W$]mu}+l{z)+y%5W+MZ^-J]^]zثէG>ՖjV2>E{YȲ&!2L}E}7cG9f9kDB vQ_ׯ,'4z|:D')S'+dV'|4[l%6=;l'K ۥ ].OQoi.M e MO؈z`4gl%l6=l'lnKvb,a ]= ݺNsY&mř/̯Ad-́ 2 "r8ȑ "G "r<ȉ ""r& "炈\"Db "MB"r9F "WD$; "9ADAG&"D؏L#qDH؏H$H$G$#qDG$G$/eDɔHD$")G$G$RЏH$ُHH?"~D"ł!ȍADJ)JTȔ"S&L 2傈T"R1H "7ŏH$H0"RdJ*ADDzADjD "u "R?H "iD "4 "rGADYAdZ+LeD&"Rid2Ҫ7u V6{7?1O?x"Ox2ÜG(|O)>g,|3"g%w 4kE` h&51^dsK!ă(Cx%P_ a>QzoRnl7&s6x/Oy5񏼞 "nq?^ -X.ey+;9}3OST{_y)/y f~3d i,h<=Oh^/d>K4^֫t͠h&4ޢ6C ͥG|L ZHgh1}I_״ѵbrZAJNWh5яDh#mʹ~UFi][ט~ :BGt9:Ot5HYt.tlJ(┫mE;q_< ڋE(:΢*n!z^xT}E?H1P;b-bU8$ qDqqBi3,G9q^\e"⪸&rD\ˠłmv8ĒÜmsgp7Ϗ8~ γ3b^&[gʿ6;x'ݼ>o|旗mv{e{}~7}>d3#Q}>aO٧3Y}޾`g,}ݾbagWkvs|Nl%彲l+^>(;ȇdGIv]dW|DveS売+d/i o|BOa)9\>-GgH9J1r'D9I '*_+r|Uΐəu|SΒom|WΑɹ}PΓc@~"OWkD~#e2].+rn\%W5r\'Or(7rYnmr!w]r#}W_&ȃ<,3yT yRyV)/,yI^+-k2'a;Ca‘p4r\,qo#+#EYYYYY1>SdCkk?FG7D7F7E7GDn====͈^^fE/E/G^͎^9PL±X$b|XXrPpHhX,%Vvpr;np{n}Mun{=s'ܓ){=nI>o ]Aq]n}}0WN4گxoHdXd`ȓi";pcȊ> ΀268 p/X Q{(Qwts@uXc;q|<ߑON|̧|gL>9|.wndC[!\">wBjB& [V _ B"r럲׼,tfv CٺԎڎ3w;ډfI3+ͦč=Lcq?GK\\Pb(iDIK6FҚB? NK˥?l5&2Fк26SS̈ɦȦSsLY)͕ӆEAD:6vf]cm/"B;ɮn$-*''4C9_P$o)A\דzs~n7VrFp#!n$7rcn7&s\ WBq\)=ΕqeW-'JZB*+s+*zEM,}lۜW)1r|.&m >}SƤ+K"qφZ{(i nQ @ٸ HbAZqkǭuǁ:@qN@zHbBi(tǩ$)-[m6dX{6fY'֙UօueXwփmz^lSГgh=KH/ W5zޠ7-z-ޗJRoWג7w'P) R\13@Ɛ$ cDN!qզ!)HsHJҚBH,$#;A#I$҃:/G`H&>.UQb =.1h=RX)K Zc4⪙'EЁt QtcX҈NIc%zDwęD =LWur::SgĜS挆рn`<֠CЍQLX&~2 tO+*NqBq( S)͉BiM Xd/9HlE~ ܌hm;x}HnO;Oa9/@tgP]CBĕb͘u9.Zz_ŋsIHF,H*/ȱ^hD zic^g߈-1:ZbJg@QCĚ:aM5XS'= ZcI(pO3]>>m3kHߓ{jV 34~vT|bk<7 ="E~/Z~Ĩ#m\\"|/Q bNQM;Jj4W6Q6'$< I?OH(7߂b7a77$[l [vl; ݝoB~#{ېt:Ӡn2%P4M&W10}2W<`ԝqIZs $R\E1(|&#BRѯ."jEv} 1qWw QʔR'vXᝨ?wKYu>q"IC, qH8!i!)C<␀8BACG2@8d8dB([%r&ncb?3*ܫ5mD]hSڊ(Tڅv@ёt< .{Az zz!z=cO3K-?T B)K _\  7:?XRC!#c>+Rϥ,";LC\|Juc_\ g69>v\97Νpהkys>\s˵֜?rA\0…rm\Ep\͵s1\,ׁi,h RSV< bF2ŒkZV5kjSS?uD%s)\*גKҹ 3eq\.T5u M-m]Pr%R*J%V *!HBPVllSV+3*Y9yE%e[;{\35o7F|cމW.{m0>#(>oǷ|{}|???C"~(?ΏG!J 8!^\B+BI;8+6i&hB1W{\CA^Ւդ)k LY&~r+ ğ $NcTҁ#mCy4SPy Py+ފL@95$ԜQsNA95g1ji9朁s&j5Y| (0wQ s| +17c7DsMB?MяXsG<kul͌+!Hڽ[hMk+b!v$aSx0:O]Si4xa<1&ϺDbU^`ߋH-`˥rlak}g,?8sGUت؞ŷFVxV!ޥV={79"F|Tٺ!c0`6g=؁`v)d 9B/tz=B?a0HN( #ha@X*,VkFa]) 1P%.+UpS- '3Jx#>JTJJUꨌT&*SBerUyψ 4g}O83L $0逨ύgŵ\u,Nso&?))$>.HP/Sܷ e?LH]$uVF2!%!e}> ;'3\E"~_R;?~4떓dv]' U?5Ws+wo.=`R8OGȫ.mOQe-4:3h)uP^O^M }r(IaXFe9#~㳒ᡬKBY1rFCuS(1VPfll+p=18@1Әe'FY,(ffC)}AIkTQ0og#a@9B?_Ex(O`'@y"!s<(CSΈ@Ek5ZkZm#GDX*pH5AsHT>) Ru%xmE=BQZolS#E=BQP#E=BQP#E=BQ!*J(*J(*J(*J(*J(*J(*J(*J(*J(*J(*J(*J(*J(*J(*J(*J(*J(*J(*J(*@+RVTK,EdZFxMLYe0g((Z2A0uYN)dTJ0TZT7ǬwfԛT҃fB6W[պ`RWc֍Y߯ ,+2PI$?I0p~=m85~߰3®N]qgvKE/bK.r{ێ!|LC+ YzT0vw}WHGڪ׭}<=2:;+\+ sqs dz xON4mjfSTI3l*\ sU2&sv%m7zۈqGT/1[@Ţ^DX/7?2ik)I0,E>?T-~:bSR*tgF:[pk2]e`iiެ\gu'`J$|Jjը Gn4iԱ)@Za])łu?U7YFw/wQ9-C+%Uvt>xbaz6% uL GKmZ24$EQ#ׂ05`-l O]-[8zf}J,^G|ՋNHAFvƺz:T$gKfcW'_nhЄG#u-_fᒤӓ+9`VݏٙhӢo7_;epܽϪ*=鶗o&Zh%_u)fű->gIǷ!:"Ǿ[U%>utrQI}pqu۠6w{ߎ}X}p~f? GؙwCjNry!eLGKB QhMn0jʓPטة9:GC :Qi)-{fd! rqx|tԸ7P|VV  &.T%|㉖9Îl=ܥ{_Oʊ3q?^k/raʍRZoI/ҽ'w֚۞LnObdW5W~Pm}˙V߼iy|3NZ׻ ~B I歜\;g9b7V&/;` WeϠOxEV=]\q~̼_mie]UϵX3ҝ s;7;\|=vUI(waUcߩJ9Y;zѬօ _5~Vej~fu`i Uv*~3خ˵F]m3\>1DwzKGG޼ݲ|?N< eGi-O?{/S1.koWq.w~uUzå6[_UwK;dNׯg儭Nؐt;22R kJV⯐j Z-,+Ji8F}qudZ`ux8}m%M/&FfGv纍,K%̬_7T* o{cIDdm;=w]69gY\n{Mzqz&VƇ VY\c†uow"+*k Mz/;jq]bԦ7b&4\q[w\=7fm85Eę5>~̵ BRݜn;mge3 J]&n~iʜn^WG7,[{T=&zÎ(;9Ϛ;z=hgGOt1OOyuSldzG> ϶or訧eOJ!+Ln|筿<5ợcJZޡdR]]a?ڕc>)婱]nuW%{wh}{NW SppV=rnΛQnuP=S+7% !&t2:seϻ9!+׻ŪsԀ"ŵA]JkQ=]5../W叛.R3y .DӼ$Ҳ^ѹMO>n:W.7-Zws~lfK9upeGYچ7@w/r' $_X]* z<6zԂӽ:X̨qkϙ(O.˹EuR:P{;M|\|&)Sd׈uz&< >q䷀ysw v!O~n9g] 9N޽L+IrG8MW FjV&d3-/V6|#)H4IRi&RF`uڿ̯]h~>\M[ԇ(1ՒAjP̵$2;_Uq^7Xy/w.箋_KM33~˕q̷9< bwV|l)_3Zֽ>E-捲U̶t|sZȉmn-.T\4:4Iqُ> 7M1%m7ZPd6Ta/;x[bRX ōͪQ̏pMߴG^ݙ!,ƿsҳs+Nt}X[Kt2<^ ϩYl=^sXi  .N1c[k_u%;Z_6/uS,s(R?b~WcPbVmNG,ɘcڻGXOz<,z'{6|6~+ˉZ*JyR1S;=~sXh9']h ߫{ إ~1*3.>+C\}]T;n{j)38"5&QK-_mvElL`؋SrX\VDUE5MʥN7}>?n}dEBje6A=Qn"{6o~bJņyi/NSRR/gt0jQPz~ٽsOYmT/a|WvAml;%n[(l*Br6xGd޹B)L#wdSq|Rn.+*g&Hݽ3&HN/LpwT"h^jan=wѴQV3a endstream endobj 247 0 obj [ 0[ 507] 3[ 226] 17[ 544] 282[ 514] 286[ 478] 336[ 514] 346[ 514] 349[ 230] 364[ 455] 367[ 230] 374[ 514] 400[ 389] 410[ 335] 437[ 514] 842[ 326] 862[ 418] ] endobj 248 0 obj [ 226] endobj 249 0 obj <> stream xMn0ta RH,Cj8 n_I4]{odO\Z+GW;锖h=H%܉[b/nA_no~stv"p/VU@U9=hGhTDB獞Z@ [+7-}2@XѴlԯ;QgkCWShhbi4A!UV #RHIɟ$s=Lo/Svk mde4#ۚ2 h0yW.i3 0 endstream endobj 250 0 obj <> stream x{ `TofOfY2$yf0AEEhŢ4ZnOkT֢XQ뎊[KZkwIHh7yw;s& `E࠰jqpkӧE.  0yZxa$kMl_6w~,ybek}(?]r2።6\kVBh}Q oi@3M.|bM/ٟQWʗ4c~6/[{#b.#MK^q2@ӅXw%+ϽUuͫg^6"u7>[>wقV S]bZ`6\`Oyˏo9[pgUS'EQâV B]IzN|%}-4#7 ȐukD0cNl[NXX0 zIA/D::^ zM!RFV[ Sbz*?|79Tv!ĬZ Bll3BU<Q|fpo73Jo&3o Ui빪d=s@Oy<*pԸͫ~Jx-lZB6ļgaKLdD $h%!6sP'3[R4N tDΏ :!AhPi0QdD 7 3 ,v":`Gb&8d !1 \Nd!z!D?xb|A#BN+ȃb>A.`K|ġ0q N| 01 !BXb(@@q8&PXň#!8 P G F&>10 |(E,ш .2 +a bq,((T$`vp~IeFl[D<"[%^R؃x"a_pnG^؟x_ D| > w!7ܝxB|A q+'8 !Fŧ~ħxY@|B-<-<<D< !vlj_C|?"fNZသ.ΙTprXM}X/ OeH#'4$IsKq;9?acsȟccxچఽon4t:])hړ9s6ľ;z=ixЯI䏢*H7@;rל[Wɧ?< <+<dŻSzTF2(寡ľ$ }wM&S/R ,ixMH'i,˔?/kz 5<Ѱa |t?Mei$_ 8_(p__0@E)=fi*K#94k  }X- ʟ׋ľ;tRsK%k%-=kyچ0@Evfrן[GK3 KQyăin$V"TFΦE-Sߩ=tX-i5N:I'I A"磛9xn) d2`IC0G4:^Q+?4@E)=74o:?7PvPhuKTF*PsK0 :ЙMX2l}Xm fEG"of2dVr[JJ V3:K6Pћ $ItMӚ?3~KtO)Mei0n?u(hb,#dclf-f zdTc&,Ĥhj /͙F}zk \XT 0d$*;.:~Bͅ0ir픩ࢺ1 XkӒ/=e;]0&d3`.,p) (/+@y_xra)FrwlE:>ZvQ#KF  <(?/7,+3۬l2*yAs,C`(ɈgTƪ3+@U@>}pTZ2> -2)_n_uMASc*c~;xl s}Mqd8ՑxoV(=X[gF>Ϭߋ}> PBCd̩ '/'hWǎ'>nZnZmj<ϓ|mScfUkLIVZ$hXy'jW>Āh@YZW5b&P~뙖DM\҈2.$-+swhhg5Mbqv. 6yzyA# 6mel:n (fpͶUg,b[_|/ۯO MoPY %nSq|9ʶx%؛7mr\{TLq 5y\JzmvƫzIp>=3V>B$6gxf>VMMۄ'MƆ312LWo0]|2>UI-Udh\|mTdal6fjʭ31].U i w>^hL_ϣhJ^z$}cc|cv$Z|r^߶ѧ|osnˍd4v2Sk)k,QnW\ͩqqOY|mK <Sj̪c*wӑV/rFc*`7%UJ~:u(0 )dܿ%¾k--hKkoK쫌i"s9`UmSs:r<5*.Ju2ƺTq4'p*;C'8K@\X'qz#}HT>xIlrʼnN:Gac߃TZ 9Iӝ7[Թ-5e玥OJL7Tɹ+c>pNQ3j_3J;&Sw*vCFavs:2?pA拿eDdXN,l9STYZ]ek6{֢% #,hM f,]и]мy+scCe=^校0(7ReOKv&M2+Ut!X? OzT҆}s4h=pG[3zyp*˞Q箽w1{n']>|Aݡu⏧yx<;>6>66t+6T>^>3֫՗~‡laBZFZq'^e>tf1l.]l +o&}2nvm]Shgv("!!А)'` L5y!^lk%<~ zܳW1%LqlC2e rD )TW,)yee2KL[)cˠPm-5P3"n%xVj:Xxq&8vk6l p[;Y*g^ y!}Ew㦥"N8 ۊS!TJՇMtfNjifgv=OӚ5gnd@tJK*CG7tmʂ~;ZQqk/Xx %X*wIs7&yK|9gvs6&jN8ߧҭ156sbc|N_ðN@;­0q+;TyOR)M #{qXӉm.$M`C À0p 4BG_Qb6ĥd!a?<%,9BDB{9fNcVd Qқ"jm" yb]d|tw~s.nzVzg`R s.ME`A'/pbrRQXT wVHadȇ]rt!l(wM*3A~>TTheF /Qаk918/\4:P5TV ${jkfLÞ,(((Vncv0|> ;8eɂNt[Fӑ8P4tЮ=%>Y 7z V@dnУݡzj#HQ!AH3Y8l꘡Cˌ=æ̈v9EE憞q}YPk PJVLC.ߝψfrL2p#8]ћn#aKKR[{3踼yŋ?)FG6]t銣3ڢf`LHZۢOv+*H5F%,mH6E2Y&SNCk,d lo*iE'1 B]ŸwixUݝWDT`),["Nt9!o9ØOb7N[d ֍=/|^[Ϛ)" noad[V̚@#BE jyǴOPB>>A\5{ƞ79Vsg,Ffr.AH&ڳa /qsy#e!nb-}o?6^Ed%VڗقnTvti]Jv(A[z-=|IU7\S4ed+y1{LY75NnLPp})1jXLŽN`qwIτ{2CMʞh~z,BD&ݴg=ۂ6xDEyPKiKu̳ÜaÞ<'jwF=Q^f"nܲͺ;eTēvgKeբ1n˺T|Υ "Ցg,Bw*YóH*!b5l;gsjNu(.,ANRN e|lvCq񱆌X [)T-lˌxX<]bBLԲCG=0"523^+~(?Fwp;7 fW0wX){0Qj?D䘆ㄳImg\`+t$*&!( 3B،{3qbm쬓y%Y{|>zYí(+ V3Ҿ}w]wD>qdz)tZ5zg .?XUi:r`3<(3+rIBEyMF ëXY1¾9>3aY97hnqu¸=i?- qncrՙל\{WvNgcܻN,F֯kih3K==ÇO:t7'SJGwPWۮݾ9_s{e9aM~5J\iFS!|8v\#Do$N +Yܳ5“9 Қms{;5kHs\!-HFr 6kXslBP#[ Y1]<_esl665`PA<<67/wI(OzGfޕ5ټل1,b`?KXf+ R. r1@z$b^~=Gxl0Y#Ct- >\ s}ɣdktdu3l&h&qQ#cf̞G a rp 3-H AIi k$bHPjT)MnnHn(lU{WIΞI4$B$$ @5A#ax32Ǹ8"Ό>EP(n#I޹+IЙo~:u]=lTBV3+Nk5GœœMAv}$ʔ 8FKZL)C +eb|'^5aG⣷/ދ5vv`UM9]XI?^~?n| x;t{Z@bO5 LkV׼h6u '|l)R dwAFesE3>ÁV`$>VNy3h55S{9u7f0֌ }Ki>$Zm?Vzwc=2fhGo=[˵Еz*N}$2j)N82lrQy2ϙ4diJ/>;9vظD8e}n,ff|;%zT1ՖWiiДrX54u;912u_^;3ij> yͻ88M ta\/0p'3-lX |fjY a+ǎgj8v2?+aJ]=|=5W\TdhMǕdym*">'1'?utM{K߲ %:ǃ~Or:+HTR4KzB*Z(GH$\.F/J4$c}Jh8Cr8FԺ gii( MLJuu4sh#;L:@%g)T=e a7 G]nq")7K刍 05?6T+9uXMeYLQ .糧2b1wNMhzM̝߃GAu,U"qj;w68܁v99>u!1 s̙ͷEz[Ŷ&2Il+Yn*fĈ!92]u NhUzFZK.mdw&@!BUDMp&G8x-U,ޱ#<[eٗdߨQɈz%g?JW~_J`jE/kBc-QTeRjEB+,gzEH1SQ`MBأ*BFX&|0ܮdgxYLN]4g|ո^Fz.qJ! DH<MrFْ2OtLmZl|t+ݵ~΋{H>azeI7W2I[ɠ_́qLL;@ V.Y;IpZY\juFl7ے¶{$CdgHH4t\ө~@hZd ;CP+5715^`\5wwj%!͙h(ZXV{iYz\ٙ.{0!oJW&Vrtif7Gb4&?!ݞ4L"CjJZDOHJb]\dPxσsg8P砠չID9ݩ .MGۣNʚ0JSX)9RnQ-8dtnqfE&y .nt^o-hLKK{uXK&'nHKSrz^My׋y\КdoL1oHddWf39姺@4f殮n_Ӎ<>tiN?ߓۛsYs9Lg| {h_ o f R^0Cas^xB.7oΑu%%l%)Z}}⁽;F#SRFLIDވڎ=4ɯv2s 6n{Z$ j\]^e۞KM+!c[3}QY)s_W ]em".fFx0mzFw %ׁ:ϴY*JjASWi :ڮ ;P~ל%i ."O0|nLX/^mԣzo֌yo}5xV~;rcQn9s[CMO7 $;j8#v8#13'3`8~CSq\(&"-Ќ(BaÒX*K&%~Q&@}rΆpHeղ($S56V`5*ݶI2*q6ʢ1;8C!;Hh #2?h?fUŊ y?VVlQ` JxGFb\PԜ!5lt=#3;*/iN"إOh[]az j!1P&&/H΍.B| M'Y}c|Y&%Qp^/3Gk=QUn c'N! \t:EG(Jfڨ,ǩTX 3k[H^:V2M$׀ >0~i4Pw뒑[$ٙ&Ov&i]⬠1jaQ3*j:z@>1A>E[J[zuj7n}NSSy}Hdlu5ߜ-^Ȼ.5N䝌*^9 W+ߕhĩAED^m2Oͼ1oۺt1oq QD-N,w ?ϛ9"jvjHAq[RP\^1u$Wi)M|;Wg e+SO[dj+*"2Iҝ$JDhhs-wltoxGfڙ=͙ѰS{#}/]kvڂYY>|eڎGos=#/}J[#iXb4g{DGD*f'mv;U$*f4bhFiv9.+׋ /&,&$(tgFP9%79<^xqL=OQ4K}q_v4_H_AU4Ga`ph")uع8sIqsxi5#v&7Yob:5+AH & `"kʼ WII Dg0'+=D\a,6$0y|\w7EQ:tй"%d`=d9]vJU`ve7\.u\3o4]]!R';dYӞq%q4qXZC0ΨLd8̀e7raN#ɵE] rGsn9Ҵ8?_㻻(7QEr.Dbr?z IÆ[>MH..{L_/Tөt˲Ur3g?ż6eݾu\9nJ_!w= lxB2%>Q*'%*)GvzIhjM&/`3VFL>8q[M>ǂsBd{E d«-. n>޺:Gr|ro&2BSဂҠlKS| Ž0:\xl-np>-*)d%s\m hx|ᝨҟn)nbJv?ȕ%ee_NqO-xln]C ѓK߆2WR}3@^PGZM=LQKϭw&Ġ4&agD/1f]! aLrMp=!B"B1h6=bfIL{/,A¬&G7%l Ǥ1K?K$q>D%,CW4jJQԱ" "Zt` bNXV[94R5$d2HmEtOhΪQl _D:oN$ }ĕr5\w1c+=mE n+lΠUDmhfSF`c,Ϟbl)T̪eeR^P}| ahP (,TMQa 6̮Z]֮Jkm8F\%R=٩ztwV4G4'(x(9r cO]n,߯i\(zaos P\+ (G$n6d'\;fIJgfz}CbpϜfW]ݺ}קf7R&Jyq8zޠhy. Ѯ !OcƤUEo4,Oi~I#9 &nlhTkLcN>=q]+ ٺPiNi>}"Կx(7B$iuw(zzz=_eS"Di|[= /v1qN**< 2&);?#9".B><MG, >Ԁ񝱓c:e9u L98]H1"=cĈ޿Ȁ+.17!H^xp= Ws3| b q, H< 127 P|I$J3n4'F3fs1! G4Nqq^t99h)872kokxO'`%|L;zQD; ke*#m>=^,=>&3oR䣋Coi3c5A'K2"1Dw'!v4>$5Ti#>䓯>R8v*Tlv{aBI[E]}15<]G9@"k>dTAs ڨ$J6 ,¾Q'I Al8o 3$(ɠXw?¾]TA@1}By[w`Rߛ `!4ZM ]̂ ֵH 3m 2@Џ[a T9_5L3Ĝ)$}R>ǓN"0W p [H~'pF|3 >2Rg6QHQ4t.P8J&~|SITR>F?pAg8|7\tjP>UF)#%s~ 'B?s N!p:y:eχI|6\zw:P_(=EqPPVjb)%&, ZN!b%2\%~KHK ><#* 8Mi3 (2ag)I%ARytQù 2i|,WRMJ9)jFsk( Z_!< <SO-ΕC œ`Ux`ah~ Fxj2ԫ -`-.\ZqK 鿞T @FRp!2˫ɂshOWQFm u˫Njm5G 1r+~@_ eawEd"z9{[EJfOE#Yg\J/^FH[-+& %x1'J'@Lx'Mc)ūg)!:ZB \h¤FXW-?ϧ4hW3A.%ktbTXH Q6Q 1mK'%-$UǥD/nFH=+g8BFl9"p EnדrKj Wf7vӵF$ KA@ai#ՄR}M)zAMZFlR r w5#/!Ĭ 磫2TW0WcWCi-?¼`$6*9P;#' UE$0U+_O16pb-kUTyp ΁_Qi/7|̧}~T? А<@hNE \uIQP5P#B8nE3?LP8fP_M~A4frg&V1;{Y(D#(Yi -SJVf+h O'3Ķ/aIb`dXGOp`t؝G?=)Yupgwٻh}}zG[]Y'={ѴFa~xOt}`0 *ľ!O*)~rf#^R:=bc ]ZԷ\SnS hu'7ϛ+?)A6tkڞ7t;+mo~߯m[Ƹ^v_}vFۖ=j>xqh';ɪݵ.垓(7'ىGߑy0ǝ=kɬnueyfĮ[4ɰ[ݦs~Ym#]o>3kWv=2-;}5<:;p62df_31]-d KȒʠB'AR25)X$ڄfz߿\7r?{s]<ǢSXK{2ϑW[-ylwnM6(=4l$x)]NĂ>9ZgH6( Pvl{ r X@Xqh4(`׋@B<)%:~fC+{||?G=0a2`Ɔ 5 &,vAkE@-9N(VJu4 7҇q(d2B095 gKi=-Ԭ,AU^FT 'K^*ތl/@svaDt2zu;)[ !oVleFnmBvJ}Յ9W Bb` .WmE\\'pcԷ!^U3VB/!lf؍"FEDWρ>$SޔRF]sy#o7`OAܛ8yaf,  L\Fr k0,􎋶85PIuF+)ھFC5 M6 }%10)Ax1_RҴ,y&{FD_$Lv^zѕWYzCF5AH(b`0]P/?xdvU n yyB:ÊB3k5BB}i0 s;El.g!'*2??-V`Fh96G.z6M2bL3lݘ%>06__u$iԋq&tE!U}FXzr?iChsjdiA-r^e(Yڃd?g"G 770n$\RkonLHnxm=}eE2y?^3wZ^duOMFKWw(+/п 7vMBXT.K, _hO>Sf!Xd'04aK(VsYOp>%ڙ=~܉f !sy2iYQ?&2醯>ĿG8 &9{֍k:8}vxdb_.{6E~=r&Vv0Lų|ExDw>jmWl11I O ?Hrh\mMi3B60x{0b*@qk}~OsI " endstream endobj 251 0 obj [ 0[ 1000] 3[ 193] 9[ 450] 36[ 374] 40[ 344] 42[ 367] 44[ 211 306] 47[ 303] 49[ 407] 53[ 380 339 367] 58[ 544] 68[ 305] 70[ 294 357 305 196 345 363 193] 78[ 363 196 533 363 333 357] 85[ 265 270 215 363] 90[ 486] 92[ 321 302] 103[ 366] 180[ 352] ] endobj 252 0 obj [ 193 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 374 0 0 0 344 0 367 0 211 306 0 303 0 407 0 0 0 380 339 0 0 0 0 0 0 0 0 0 0 0 0 0 305 0 0 0 305 0 0 363 193 0 363 196 0 363 333 0 0 265 270 215 363 0 486 0 0 302 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 366] endobj 253 0 obj <> stream x]Mj0 >$݆@;C!дpl%54QEn_ SO~`L0yrk"8{Rutt嶋J > stream x| tEW33Lf&$ fLyD$ RQc6`YŠT BtAvAE]_ rWuwխ_ߺ p5tˆ`ͼbN@uLoqaxP5^NMW]#<;%^_̬5og(?V:pH.9L!xӵ5nGL;~vFu/<{*DZ,0^%x^;o J̵3͏dl[CsL~8IOLשN`w~?@jDgL-Qs`g:P3<2s[piw>EO6YnX$oAYA rLn[xͅ$-!r̀AhE}y TQmTzMHY0Z̄cڞMz+ǀ^YK qo\F93= 󠛉 #4ź9 0_Aw/QjMUV=H 6Q#.Ȩ&(LC eBYT"? qW(ep c JVXr7qcr4b;J[+K=8=N"B3-+42Z:LW zH?X7{7W|VSA z EρQA ̈&Dς6HB#~IDt@2Sdp!R  TFπ|oR!~@Lި/b E AĀ0?d!@I6b́\E  琧`>  KRB(~2K,b0 ^C@%p9PďF C.a8_0 ^!qW*8&D?0qLBe`2D0 B,Sp2\XSCTF^P8EJFE߃0 fDOA5DxC-b 0f#΄kg;P g|9 ^ usaaEa1XXKo.,2% .oupG\ 7"`e X`=܌hBl@< +෈+fZoUסIfVmpGkWaĿ`=Њxl@\ @un 6#n@<{-Ꮘw}7W^ї}O # <!E!lC G_|#>ࣰ1}"І v!>{/c4vw3`'Elga<CܣSӈ8^Bˈ+ѽ y8/«Hx x2 7x8 _7[w'_Sux(71x8M6x NGw ; EwI|vi'C _5GM qET;v> >_¹hRk7 @EN=q7d(_ C@YBK4niET2K\J /c|&j|˦jf4Qqj"$QL"l3S|"%d_KEi T)_&4_)_5$cjqQ|cS"ɚd?aj4RZ:DS5e67萯j"ˢOWʗi?/4RJеݱIFazG#U,KH|k/!zn${0n2 u ,F@Qt :/[,J _+1V0,F0+.@we#"KP걎),% =OrXLhAh_WJ\@OW("E%3ɗοES0f5Ibr$90pQz 6|%KfڄEN=q7;M? C$9KtIt#͜@;o5Z .*D 4]|_cw#y3ԙ% 7f3]C4B5Ņn`"#.@ьHw <su܍|% g&'ᚤu఺Sȗe︀Yˬ|zj=q7RF ]/"dHѩ\I>C/;:@\JDNW1a;~Su܍/5]Ѝb i4z0@jra3 ;. 9b6%l//r걎 A׵E'2ܴ|)}{Aȋ t9r3]ȬjI")gpgdLUvo?:HdDט08. Sܨzv5zn<nummh 5^ۯh`޾A4{>4Eq=O*"RH'}Ez, :[ sHŔ A=X_z(;^أEJCf/rrTH%Wbv͐)1*< KТ2.w"BԾ] EN=q7ҨQ`YӻJV bh%0AހbP4qd(/6QTRWO:FP=}JR`&tq \ZF ) JqF? Ԙ{n)NdgfW !LC񢫆a$(.w8K]@BC=&xѴ+X }0X@z.W`j}):^b:_Zc wKKE +Y.%͞3~h0+'K5+hCzpIo3vxIeGH^'wgPC]SC E4fl&\D@raEn.,Eϩ{2srrgӻWF?S\$aH. w:(hԼc$()T\>u#l/ ~('\Ư52_2v }KX#@B,NJkKgG%5UUb_F}6X/!τmOxuȰKr +f04ωWU(5ՉU.Ybg$—D}#nײMiU]z 2WclFiDc)U+oiO(BV?[BIyo+bci\xŶ:f{eKK7e\ybbEER98GflNT͡SMY:۲j2Z|0տ$RZ/)^ OT0reHЊ΢Nᔚ٣ƗЁb=^RY*t#w7(:ŒA2}< v2$[*g?.,3ojikjnJmFԕV]ǖcUȰ F _^*.\p RXZe:< 0E&Wrz>cGHwF91(NOIGsU[EdŸصp0ϣPcDkV\7]_-3JvKig#rTKHRZ!G@DUUXLhӛ5roiK\ b%.9jK999Q۴0 a^y Uo܌ s#敘0cιkƳRYyżfƳ m5&̍Wuzӫ5is*x`./x&cTaι 3~70GABpy6[ь|!skA{\rmIþ#mdEӚ5YEE5Ho`5AhQgpl5}L3LKήPa3< `&99j]G? '|61͚bs.~Z:m*(如iyUi?5wl4{ٳGm]RFsNaakU+  DY^0&m#'Pgs} lڡ"dzYtaۑ#x pCAcHS 3MHt?4 98@ݍ;zף l~Œ)Щl0t~: u-ȶ9m^a;ҙvIn^i$yƟƘ$&;AȉW5S9r̖|G(;{:YZF1XE^V*B%[{lfά2'J Dss:gnr&{H![&Ϯ+[jՓ[wݳ2W6tؔgEUO!Ə1-cGO4h|` F1-,kn,`S91:#Nxg6ыOugg*;* $|f¢vJ;pj@y:)4b:۬vv='_e /+>|DUsǗ_(:A1GH Uvj/iy{AO9^zEAvVF|^F'?w r},N=\\4嘑 rI}|@n$F]7=t?>I4[T!I!_/_AɎW֌C3o@NL%Xg= :dK\v;2Zvɏ J9+Ȱ eU[ KN0+!V xՂ4ܺ"qWdEQMpfPa" |BZ` 0֘J x4:yRa-7*XDKC\eq ^VXTKϯc<ބQzt7 guzazK"vtvZ g0;⋭IŞ)&셓M̔㮳t);&^sϯqIjoŎRheG|oT~B`aNcpd(6ؠn$ZKLq62dWZc/;Z*/_kW}sp;U[f?w`ƨZj1f~3daQk:JF(fúȈy sg;jFQ 9w{S|K^- cr! ژ*%8N`ȏ5<)\vcWsXnY."%r8VDvPabQ Q!Y{LIf31{b߮ӑJih9F%YjB=PETŬY%j!͟f|E1~2Q|Bm8Vڳ+3RZ Wc= G!V%I$mĵ[2ů~7`5N\F$C=wۧ{}ɾґP{T|Pbp!/D+FHZP-bٌ6_Y>aģSs\=NI; + ԉkeNbzˁ69O+ZVZC|OAyRrh0zsgݎ|9lv&'P^3 :)6 F %ksQ3It׻w)Ͼg 员B˃GN=BKOzpĆ)r C9X?_`,,|߫/;4^>}sJ咿/giͤ5e+3z|Փ9M}6Ը%|2QbPPuuIm2넧*n_DB iȠZhVQjA:+};VĨHWq|C85 T%åc44JE.Ib8Y<&r 8V/#N4ЫBC!eB31:ArBj2#~n?sٜ9ܴ͛^,'/>=pB%pF* acvWY뵒h4.[#rٓ,&ԃGѷ\ 3Lqei_6nR]YWS3y5qb.$[Cߴ{p,WX31aԴ<\N ebvFU^P)VIz`Yֳ[>'[+mO9F~Osp_D W3@DwTI-|PA}tENn=qI:o܇ltlI2,'lj]~̊a< 6΄<2luiRٵ9ɽ9mяn3?'72tԠ%oh?ԲZ7bޘ߻UW3 ㉯iΰK|]pd340Gp{#U\pr\&}#p^wu$U6h,T>e/@(T. $6? X9>کyLKzOc^(SMc@ !彁Ad9Q8ŭFL9lXMu56r`{Z?<4u˂[DjΘ3d7e -^p!lFv{6G(X f/CI2x Y $A$Q6-'UJ%ZޅU%CTr^],MW8*ihTW40}WTQ:SwVXW=b02_%؄Usjct3qit&zBRv;._T9)RN&I0Gבlݰaؔ7ǧ_:_>F>x{qطf9ʌoX4 ophXSаd,IL M]F(PmtȺcfϤnc2EOo؂wْxG-X!Nյ$ago`Y)QcSʄ·`1IT-%fڻ$W~O$Gg.fqw2oηnwبVsd4 $b9sr5XL:_<$MTy$4M'TX.HIK[Zmh6Ћ$-$f G- rxP+ " x~f~o|ͼiWsR;UIP 8^ %@r_JE&NɃ*oJ (/cQokDPڔYQ554d"سg23gT'VG{et!k'(ѽ=aVMH'*u۵yYl~S~[{8eMmQMgV]/< w?hAɆO ddiׅɌt%SICۻjjOڮ\ǒ0aݴ[oVfԼ VObӽwaTIUNE %*HC7q)l%QCZv^fqJ ξ{Ɏ}w++w>pbQm;չ?KAj޼#ǔgʿo">QSpB$Agj=3YR+)JR ؘgd,V %ɨHQJ?%Ӑi㐜p|4 <ѽhM{urT{Y+cѾ%HQ)V zVqI5Dp4MΑa4,1D5C#ЛdAaBa J#1:a5z.0EЪx GAFU"1@a wSe"nU1 hQ͕a/'J/Jb Na57DQdXCܪ)h"^nת^̗c w#<=$aI1[,5`9Va3v {ozma:GaGO@=,`]N|)HcND] S!.O_w+S0G_Wװ`NϯKdZi? #|IA׺2 p*dc]4vDY!&Bn"Eؿlv"K;A#icNN6mptik9:? Y4&.XϹ t6/lyfi1Ⱥ8MawzhH;8`Y "x?" ?g❈J0tJ.^W62Q'+퍵 [i4y'8 lﯡnɁ GĐAB~EhCzy̖ i _ |A;t]0YM0Li\f,no;a(,J'@{YЙH.Ҙf6 ] B ""륽42"8saw1` i ;! |=$A_`Cgy/&Zluxtq 6^e+Ej 0O W$yA8CG!4 CXI|0= X?8/6EZ5pRαAmXRYCu1O!FE0.l ;șzpl=d `h ^}uC,xufk099`bmnZZCC' <ϛH 38/r|Sp#`;%hF蛆*%PރPsc<ݡMpuB!,Ih]Xd]Oh%,'i 07x`N;p ~yDwL#S24f@i8) yd7" rLH,CX3UUӋ#D#`he<#yn(K+.ʼn !_!%k2_RNl{ǜ+ͦRud(3J9"5 ΍ C~EElIdzv$/!-Ј{[#gGzbƃMBőkq;;5]3cl(WʠYbĬw܄{Jf#5턫YbmBx*s0fWr6{:Y1rc4zP` ev)R1%}>s1-A0lyݍ10̬r3 ymT?j,5ʧT5@܄' }H# eI-f6.+@{SI]2Avt`l}^7H3-aK^NF)Z[~dZ.(H؃H= `f$Ed+HT0>6!FR>~óXTj~n#~:nء]+ƷiQPEb7b2_}eUt=d1c~VVRڄ*}m^ѝ'bz$F=3LEmMd} ֣@@4`%et4RbOM @Oqɦ۳{N6iLg7.sF_ 6'U.rEs33_jh1utn2=ߌٕݎ²cW u¬9%]y':⪛[΀wHTݞªJǟ=7jSU.λtڶds9:JkBB rƭ[M?{g'/.S7p!6[ޮgCq[?77q_ٴd"ՀTjj󿽘\zqL,JX"s"Ӽg!p 'oڞkek9VGv,%wٷտ^Ԧ9S\'uS-p'Te/:j/?~ܻ13cwӱ״-`.2l=h[OĜu/W4WSoOxywLzUT`[>.S3=<['|,*^䊓IV~=JycEߜTȪ9pGyE_+thlEZaI?JԮTB%z |b[ R5:EJfc{(1J :yKn=߫9o!9abΐD99SrB@"!zڀ`cZ~ hG#m=kCrq,3ZⓉ9`@KeΠSR  BUwt}1FE͘ġ Mv+x ĀߨczHr._2eebR3p Y{!h(ZHh[[>*@o\C`XQC/ۖ3o{>̼bweODz/_gwcJ{5KէxŧbR}{GSb;NpU]#fp7_ΙXzm-\_1-EgV=7μiџ]SmZ~*[RKW,V߮HX6^r#սF15/ѸI?^ t+Xz\יGZ+I9& )Eί(C01(B4/CW$,l[ɛW<}QŴlt EhC?"'Ƞ_.Yj"ۀ cZ-"mBs֡M|&EEنpЩ杬rqʚ pG> bwFrH0|QTYDXD C@c8Fuւ*"u)@bFBRS}h!5Յ8A Fڧz:=3' i砡4û*kЃ ̈ mxsQX99YװIU:4v曭vL;d.KLRsm*+XK,X Z]f)+ʥff 0;K%d7pi[-ɴrxs#mjY"-etՔo䛁 6bUx^\nYa!ma hKiEE\]a5ltV`ĥU rpֲJZe`]a+KLVZQn3 ,%%tY];ΌTbe6Jb*Ini–VVTj*2 l"=zx@e1aD,v~Vns٤D0$V>WD qa!vB 3A'Ng((e :9HEXLYM#~I۽w3;LBS[&I3si1"IhR HST1İ [ƄoesN<0^rݥt$Gt) _A;%+OSW ~y wϳ =a uxiC/M#眼gGLSikHqgm>hCWZx 07o> ^{\{zdɝ?ݾ4{-#Ǿp--T.Au&/X?& ih1ra`ucfauRxJ.6y{ǘ12n)LuI N*HxkӠȓVǘĵ[${˗.&.8vnx7?'e;B՘s޽/G=~%*{wjᴡ/=ήJ\ƌ?)wLWoZW=Xw_zC_2ei5/9Soߗ=p;lsdmo=}ު/ot~ؕ^I;x裕m;,G__[Ğp~OjVٺNIw˷TzŽ<7|6/AP5<1]H1߃dәS~}ۻU~__4Sg\TMyk Lh}十G+w9_߷~c섻>5=-돃U>nan }p3{ƜKxZŁ=&ӯ8sKs? endstream endobj 255 0 obj [ 0[ 1000] 3[ 278] 16[ 333 271] 19[ 552 552 552 552] 25[ 552] 35[ 979 781 698] 39[ 802 635] 44[ 333] 46[ 719 615 885 844 875] 53[ 677 604 719] 58[ 1167] 68[ 531] 72[ 552] 74[ 542] 76[ 271] 79[ 271 958 583 594] 85[ 448 427 406] 89[ 510] 178[ 500] ] endobj 256 0 obj [ 278 0 0 0 0 0 0 0 0 0 0 0 0 333 271 0 552 552 552 552 0 0 552 0 0 0 0 0 0 0 0 0 979 781 698 0 802 635 0 0 0 333 0 719 615 885 844 875 0 0 677 604 719 0 0 1167 0 0 0 0 0 0 0 0 0 531 0 0 0 552 0 542 0 271 0 0 271 958 583 594 0 0 448 427 406 0 510] endobj 257 0 obj [ 228] endobj 258 0 obj <> stream x} |3& IHV #]D@#Id1.O Wׯ X l}(J[[ZEP_D;33{ssΙQ(.?s&⋗\T>X\3XOZ+_19+֮H^CoWX璦 +׆[3x`-0ֳ- YܾiϬo 0v,Zg^g1MpSpfJ[,rtvpc;sz2C]dZ ͯ\@Q"kǭ]dwɜ =ց/O?oQ=%<8@gbC%qZI5ܭpp,ρÅ|3"}^sƉ3g\^ZxN@6ie vkxf I5=^{5G"i' .%WON=n:}cIQRw+A|i\}ΰKQB<D#4n^bq_Hyπ `}{%-`}Y(<gs!h<<򐏁|1qP9?+C /5Aal΅(O@><8$|8/v &$`2SO4xSQ.F1aj0p"w y)%ȽF>JQa&xPs!@yepřfÅ(A C ; 0<(G~E>*c'`C^b'`!̏3M5\%RX;5/ȗC5J@-,E^5/e[Uy=WC-{u(aʍP oF]@y 4"oE :hF~)ӷ-V!oCף7druȻRP&lp-{ 2D߂+ +a`c ɛQ~e.Gm"v e:ocp\6#Mp cGa}pm5GỰЋp=[߃WVK7! a;B*'܌.n+܍U܂ ?ېp;?D0p7=Qf܇O2<{ !Gñq ?F3{h8(?{QCKx'?Ó(5<7bȟf)sAp@{?/P#+ B=/Q~% o ^A*FG93~ Ďs&# B{ޅQ~^B} e;; '? "C8#x= |'p,47P7io?csx7;8x51O_O)|)>ݎ|z +>_O&>}5j>tʃGO}zyԧSf^~O_VO@OL}߆|zWA7rPzky'|̧|1O?|1_g>3O坌S~ߐOkʧ|zʧxǧϖ}y̧_t~>}!鋘O_,ӫO_"|r))>2~|>wQ>O|!ޓ}M265 )lo a%LHiL ˥Mfke΂6SɒN)ñ9R4J¦_[, Ma3E_r25hFa%< æ_[ɒ\=|:RTV{z2J6 ˥MuFa%'1a,d\=|:RT8Zz>_[itru )iB>Y,!6iXOQqifזq\=jXnXOQ4+YȚ\3,7Roxz2\=|(E)RO &0Lf5&$W߆)JQr1)'MJ3,gGI4wZ&dff%%W߆QRX,g '#grm%(5jTrg Ч(EiUYQ\=yX,H=5ѣG%ʓoCGe6T"Mpf8a!?_(N7,\}{#?=^BhNVLboG/O3/{iSM>y'k_(Z7`L~ܜQYsfFɘfLU6щ QaҼ͏ BQU9&*603q-~'Y,Y 3N+lbpM ,Er[=L&L:f XZ.FIX[PҦN4#Fp?EUV@.WD szImEyAaa)Q2ۜhf3vnTǺt:]r346mUQ_GEʣ.{3or߲ڨaeaAlsu۔|oE^PmbtZei!uu)UKk qԶE:l(ɛ::Mi[4[kXczpB]Vk+cwiϾ>qSi32eCeLbTQǗ#Db#E mR 5g `vN0TphQQtd\8Y,_2uʆh-lUdP]fL%/,Wy1ݼVʋX|Ӌ\-9/YNK6K7Ώ9'8/Ӝ;uF~Eq@*ۧB4zk'{Ll轱/M%ފ6?hͶpEC|JC Z .j)FtZ$Slƺ5YUcZrIX _oYrOM1 /?^mmzA{m5 MŘN.L{0btXfLk0]ile%<7W<ÃwԛQ<2(y6j AλxM0tQLZ ,C 2Lk00]i]^ä+r\>TcjSݘ`:$4|.cS>>eh!LWcځi=+7>es۰ 5mVm|(&ȩf ݬ\,8B 0UcpNR[Cހ)i3gYffF AA(peK7+i'l fh(6>nCppppҠ3dꬺ2b]H={MwBT2y+?罻=A95uHll:N6]I6ՑMMȦĚ8- ߜ_k ϜW i O d ǜS ۜ] C 9@ j)) %O1o O=c[;@+ֳ/;9+K ~g{{ ko2Om/Ţ=cQ{ޞxLJy{{^S%=$PYPB=)ĽD.{=-ֿp?jmO-(4zY{fϖy7h\~;{G)˽\3@^+q~6Ic)ӸZc]0#7\+?f][DQn7/olƅ3 v\L8u-ٹBXɟWQさD3P66o PjylkɺInns]e֝+ٸo^9þs헳SruVVBf`1=N~|ݧJu}+t}uE91<}>[73&}^=ǻDGU\UR=UbTm-$!Ѭ*Z6'/)B/UEuߪ';H>_W@ T@ϱnܢ/SސD{-}TgPg PWU>PTy߫>4.Bl\]U4T#O>%*AzݏOq߁zp;S5@ A= 4ndWѮ}u=JqS----40-9FVucl1r%ԭ6DV ŗd)d$K6ɄM0죚ڽql4g= 6ܳ~YKg,[B _D)L9V?}7 6*7E77bgĆƦVzr$Żij[y?XVۿ(߻ڷ/׸5t۰n+5Ic[ic!WmIoōh_Ѿ}/R[um]%q4{ óحtAaU j&cESgOM`E@.ʻ‚Ȍj .qZݵrIe;5-ta꒚r5ێf|!REo+|Lc4C0p1Cgwh9=syd^ǝ}_6)5y E a m 0 BnX@(ԃn;`.,AX>lp'3։±h@Y5ǐ3wL~L,;Epjc_=6~OJZg=!x ~}d~Oh #هp\Gvq<2i`p-^"y @Np \p@ Cw ?( ߂I5yF*valQGB[ S^)ζza;܅+||Ndi#E&/G77DŽO}<<<B,kg h5K5u>MӚK[ݡPoCT#nCq߇_p?C|N]p-QVh';Iaqa N--\~,Ӽ5'1|O{Zz"/qo~ {g770ۋB˄BKrݙȤ3/j3(v6p =F_ZHL >4 HVpfA!QInv6YOKwOuy|Ldǽ^(+;^o>n/&xb$%Μ'>6y냤73>xf8' 62C hZYs z=s`Ԧpp$p >#p}"W#waFK`2Z_TqKK44;f:ţx d&&'ϼ+qG>őf}?7 V㸌jaqMF˸+ѨLƴ׌eh3+o37>oz9 -p:I/iˍ& c%ft._gL&tݜGW][K[36q24)-=4&̲B],kt[/j^jwwjwL벍JA%eƺ @l'Č-dZ/Pe>Sq&SKԙhN[#mWڞ4͎46@|fa |—NTW@tq"p>OỵWr?.lgz73Lz.S̬miE•_9 ENZ~z_8hw)qZlb#+Oqޜ""3?q^́>|iD8H;|^M >9~+J[IwU0Ia$9PҨe]8z7ƗղߐL.|Uuq?}|8xYp>=cǍ֤&fk4d9a`9v[lz|1f)/H3yfKsGsh.'(Xʑx)Y__XAl9kq:rGGswkm{Uo<{vYߺu\7O>laJ.k+ՆKU!UחjdF #Z mg2=},ZG'Xڮs./YQꚾu3mSX̾SzŘM I#.k CHO8 uCH01M&. Fĥ@@ٝAڈږ68"مD4W13./F:́vbhYb˖w#f&rGP’N) - 5`Sk5E)k8P*bm#"FBbs+܆ذ Kxw@g{0Boai 6:hX@dpg)BGǠf\31>PG[8)xhoĶ_;3ov.:ANۺhR{vƎy"m;́ 8ejh _iB g5BI:MDy D܁~5zb<<(-Vl$HL3f܏ %YC1t\ހ-gӿ$ h:m tc Պ0C1.?.,IlKGÏ)܌-3KQ|iErѸ!(u\W}:kAdmЄn,Ri*J/ClE` Y˝$fU!ЗPƾڂ8絬Zj/CҨ:ۇ݉m6Kl t5`#T}-?lg-~[qEz"̺G)"ּՍ֊!>~2¬m:&6.[*lYoqt$FtEi~#kUqm%K("H/E[zͥdM7[i D}ֳMpa]o I"2kcm6AymC<̾t*gCZv%<әI C3棼Y-L+߈%AQ6>B[lR H^MFVI}]6ffVsp”BQA%64vK6~&Vl>Y l2Q_Wꦡ}NDt"lL'8tGd/#G]2~O*mgҨiM42fZav "7Jt}лGZq0CP;sM:Q*5tHhe˄G~qGwv|RF̮`dhuXH6|S/ 3VJ&습3\5펯1DCNT镸n_:|\(4/>wY3 Й aW= ?1=톡'N#}{7?I<:vol&#؅*ap!r/l`3Ol-߻C?$;_Ey@b1+*̻"q|K[Ox8\,UWsfT%/ڙ]:T:S\h+f_FQTѥ]dDEuPK;.ŞK^` ĸ!.ANr npdOɥHv I\ddOɥL L\HDIDߒHD 0C#u`rH`r$P:䐐H Drr 䔨CCB#uqJq'as ,Pw8%09`rS3&:09'[LnOD LLɭLN LLɭLN LLɭL. LrsC. 9rJ!%!Ǖ@N:$)UJ Tr\r\ 䔪CKB+RuqIq%S9. 9rJ!%!Ǖ@N:H)I TrJ$$Q 9% x!DBNI9u)S@GY>'Q 9% x!DBNI9u)S@GrJ$$Qw9uqKq'Uw9^uqKq'Uw9^uqKq'U%z%Uw9^uqKq'Uw9^u)S@WrJ%&c/VR :EMu)STTR <.EMu)SZ>|J݊*REMu*TQTR A^EMuH+jÐGG!: y$ yÐGG!: y$ yÐGG!: y$ yÐGG!R`ȮC C00U`ȮC^ C^00U`ȡC^ C^00U`ȡC^ C^00U`ȡC^ C^00U`H#+R MTH @r*J :u+Xr &P}|uKuաEr]1RE]b9XQUh^E]GajCm:VʩWX"XPW+ʀug}u:)u n]"6Ѡ:bnh0goQhiE֑v3Lx۬ԇ0['#6Cl ,DЁu:qzH%-bS cEױ[H0\n%{uiPODp+uN,\8p<\'J"cԃAu4px߃uANu℞H#%72N^ ¬V#,Yr]"!`:Bs8qu$r#:\zN@сu ]GΈ9u|#E]BňLҍgB iL3͡N|@ #V7&5n#C]ڡ]3C|]GΩ_ 1M@/!fˡxĴ]xSu;7]G#&l@:2m0nYTEU=xݎĩ<^G omb$qF}Xbv3-433<1o`9-z/፧3^YI]^8>!%~6 KxE_8^GOzfvI}V_o x`g䍃mCcs 덃#7& =TgjoȞ[1UMs+0D0pQ{܊#pVa'=a܆#:6atۭ<vq2h9{`gCzoRUq01mfGa6p,H#·ۈY #7&~f@|8xcsfϱ9(>NJO>^v̭r nVkPDkbg[ ,*|EOL$Ž%vp@OMli7xIo d}3 ZPm#,,$Գ$j.x$8x@x`M /6H@o x$8!l5F $^pbHmԌva3AT*cRxHb'/pI\h!@x`bx ;L@uN>:vpvNQO Dw;u .ۉnnfs6f&s? .1e .V .1U .U .1[U .q;7:Oki^/)!׀^+Xe++/cp|/x2^\lIyR̻O5fLk?M) xm^u=b)C°.x _i6/7 V繩*[5oo>2aO2ӊ{oBvব۸C+=׳fNծ|=ng8!hcmLhczq ܌vkp%5߶5tdΖZVWܥ٘6e컱jǞvrμTuP֪)|F\lԌ3ݏvng^G&sGM!/O4>G{&nZ3zmƞ*~mV;I7l,mIٵ/Nr<U߿嚏\gxnZ-rj膃 7v1w_7V۪÷{/Q&/1)ښZ}wqS?h%O-TMS~;Qk)Q}7]h4{5S󾉉u"b 0aȸA_ O5(2q`Pp#/i-_iCku5?099~`TI~kmghud+6um!f6/uR"zٞ{'kՀv<鋰bѭTû|=`7JҼ` `ޖ?_n ''\xoh*Ύp5۴\ӯgS-'ŮF{lڍ irkFVKgȅC=+nU~7R4}td߰ڸvoꕳq$3kCk {Y˙wu+]h/F-*V̹*&MkW3No6X \[kϵ6&(h`ҍFRK]ުkU_=(+64C2k3QZm)qT"<*!):2o ߤOum7<`OU]xCFݶ"JyxԇT|3cם5П7XJ׺?(¿ʜԎ矜zI n[/eOrmھYf[&꫞7v 2̃3Ts/i]gC*5ϼ?6S)ͮ+- 5u_:ڛבּOWkRhr-lwFjO?8Ŋacj}l;OػĪރqӝ_.jyt'ײI*칻wwԅmsToCs Xu}ER תmɉtk^7* $<&vś ̜{5ەٝ9>:Vn}C&S,lݓ e&ܮNz4P>t^^wnk]yklF욊-f7jjoҜ3R *^mK8壏8_g" [-,=-M,v'x*mq}WJ⓳zp2m ~}rS7q~ze=]xe^fbHcO*jO#~'d{iGC)7b'}q0Kufe8{GL|0{WTYfwh>Q[l=rtvkzu^G{+;cO}?רHwf97 lΧ:%qZ[lϿ nmƭpj{l[뽭T1;oMrD'HOsk4R9;9iA6rS4߯w^Ÿr?ʏ\"8x7н4ZFٿ)RޓM 7˝[fƢ#tH4̨R`K%c',YFU!q}z5T#;x;ţjU3ž [u %>\oӪڬåEn{nwJ>ϿiG<^郆nV9gkxKUZF_MI]1_trwcdjbӜޞ_<֖G/*lڠ!#x>E]vbNsmYݎ.*%})/˧Nn)"jz\׋?L 8yj ?N_0 Js9}}M4"KCO EwR8<^'8EGM+WrV-[&|wBDFwd _ 㛾?iCT. ҩB6OzuwO,/V?8;[ϟ+;eWl}dROK|ɉuGε;,'~f#.uLމ+rȯ.l9xlڨy4ݒ6SJnʿ^bN|OsĂ[Ykǫ,W5|.%K}K6rjj[(bKQ*|A__(>iYư_mjKE| endstream endobj 259 0 obj [ 278] endobj 260 0 obj <> stream x x]UN󞓤i9Ipڦ-)ŞCKC_4`SHR"-T XP(oEF8=8/^qFT(|?XA?~t%9-? /Y#Mҍ ՟ v{ek=L앜coܽaUWL^yq_y/_q^umZ- ۛ}nyTl=M5O}ی7ni54()7cms['ԅkk}s)@>~VH9O[.źċZ:^ԩ@닉1\y,Xfѻ|uy5ڇGn]Z^Լw``Qsr@-7';;;zs+E7kv-Zj̢o͍U=on6G&}T*J$ʠ^\|}BՉz.kXX'Ct\,MhQhmsVr[^OyiM-Rn66u._LO偪d5=ۗ;\\ѼN״u{ 7Zr]*I͵ 7:hD/ȁxs\< ں%$Uz9AtD;C4۱O32sQ}ԽɎhӽ 2^&7=rǡo2]ěseK nӉ\~|iiՉLӷ1xgccPHgeE=ؼX}Mec|Yez,oTlZ:勒Qubuy?<[uܤpK260}FZ;.KdNVj\cHM} [ڸX)U*cq)b)]VslBŔ{lu 7[*V\R(<3$ 3ϫ`(?>?8 [nu$?mF:;* WXlG`mN>}plBW.4Oգӥ/ , ٬R /MYo ~ ^ ~`O>H= (\sBp 3~Ed1D$, >gWS״ vf4TA.9廣|W .kDZ/QiB|d@ǂGGOk:Jzgvt (TViyI[|8(8-8]w!P/`BZaVi?R ʞxNJ-*oV~,8X\2878O{"XҤ+|==8E)Qjk zn4''T!٘>`0YnJ0!F4Atl)O7%lNq4Y1q<=,Ըtj Oד4n0-j| AR9NNbP[Pl~IZPܣZ|YFOƌMipfLg5^+JsSPJ= %z8k̈e8Wˣ\lˢ(Ǣ(7pK4`Wdkx؝ z*~m 7*\7KoMDS Yӣp7c)=e;:'?ž*0v\POgOľ 'n;Q[?^~a߾R>?/JddԇSZfWu6{'g+jӆ/GA&׼l1Rl+_7V]W}B12;ɿB]s^;~94.W//זu?4GyxGcQh~|C&G]R*#_(.Ov t5f͋fFhcJfլޠYm?`_^K}Ei*K+ DžP/?+p-?i.Uܧ'Heb_Sc n9P9&}JvJwW^U֩VRV"ViU.\= ]yjT5EP\yщz4z4FSz5n7(7('[7*(ܬ::t^o^5{?xjTf7x5-;j{IheS뽪Tsg U.QR\ةxLW7f5Ttt]9K=8?%?o|Q^}-OF ~q(Vɟ_!-4MO#Sm~0)ݗ-Wo7 piZxF5eUXx?zOʶ{_ *#'\8jO]oؘ-vrt 酶l{rf6_Ȗt.~tvMzmێ|.ͺ'o*2IL~ԸRۤAwaA)i^Iԛ:})ˏ {_^O~w;WJMs1-JoyoMa+ siiz~wU跩|*=<_xKeγv8;TݯJ*ҕ\7Eݓ:L+ԏOfifbHᛤʜSd&:!Ǟ9vc7zơ7|{_Ku4 ..-MkLeݥrk㞦2IsۦŅtgvqT9!lO =]쇷ިwv8'5ա:ly4).{m@t;+?!NwgrN&EN#zL*akLߧrb3/}ѽ^z+ \uN2NQT7]]ʽʽ%esq真L+_ro8w@n]RW(ۙ7 &_MgƫS[r奶<<@z.ܯdvwg?w e={-t]ͱ|emQ͍IQ%1Xo\2 PUje[reT_Uufǻ9/O3qKʶ(1ʏtn-w"(1?e:PᚸP*<͑z.H> }xg{+RW$gEQ ht:_?*oi_@io -qnqLJ97;[|s~ܠytscX,Ѻ|b@t.tYk{,q}X3N?%uV}͜ה^.˟.}saNA g"g3I : N9)?II:Mo<妞%ޡ|ꄩORC ]syy w6;Nq uA*s\C:s[]O+.wNoMg>CEIegݎl oNe{S 'lw#w(-{/EoܣZ}87x+=4v܇(? >|_sv,ojT}lQlb*'xS:*Öq}aH)(Q\w^z3)r lV )7ONGΏr|m}BvۢEYKM?M7_I*'(WxO߮Jҥٸ|)\;P瘙k_ho ]jUOW;["-؎(+A8U|6ʙ(/iS\`lQ?9W'UQCj]]W<ՅAm٘ѨtpM_uqQi+W#_\^??| z &ҫNoQ`z^.875|,?9 L9Ͽ+l[0sV xYvBᄙG+haJ*Z-觔]X_0ZH-105ZH6E v$B$9u5MNNsak,upyP/j?!-]1+rCzQט.EOZݭ3O(*"QLv*z[9E4rg2FΖ* qJN\*{5*Jޱ*kKU)c2%Vʴte,62.$ir3M]M7m >MMJ +Jמpƕ׍S^]^,:UwjeNLuzɥY\Qݎskjsz ]sVv:vք~:&ٻݮ95ܘk^mS\Y޽uNM[zzzrs;m˞Ը\[fمzLJ6n&[ec*Mݓ'vNX;}˦I'ڸqpNM_Z^%ܼx7[ںq7} MҟܫO)/|2NzѯGn(460qp޹W_:mGm֝NxMᏍQ䵄߸Qnꛣ ~Wim-Ֆ"*_&w}q?k=kϞ=fͬy ܮ%CҲvK%Za !wc8~ûɇ9qŽA(t\8RZc'ruF5Lro-b< FSS_jΗj{")Z㌮1s^B?~yZӇQ:lp`5z>l>YvlN_v4xSK2zUC]<;[`)PdIEYy]'9Q '$*yi@!t_ 'm'<2DNJ,"Q%UCF̸ X5_pK#?15e"3،mg6cXł(IAPQgfsfSP2 &}UCRϋb0{uacf#aN^g۴2;R|.: !Fq!匱j1;؝(U:rjvbqR{Gً N6 ֡dP8]=&Z|Ua˫ZTt-i q:>C|(_P 29`&8 -v 1@8h??(,:FJ?l70(_ G! yvJmӛe_.1t^i g.'׽0R776p tj׼/642 k oK*4ax 15B-Ƿ;a>? X [vjVFg-SH9Lf;wV , ߁F''U\ 1ȫò`S6 |Jn;P֒v-՞ViUl3hka;{e)nlz%hw 0<kQ931|)Ja7 Ry;4-A.;=]lmbQ QFWcw[x%}d߃Ǡ6S-mS{, aaYxW5r/b8K Z$`(Lp|G[k\:UV[,le0pԭ1caLR?`-Qו5_#HrGR!ڎ? Tc`;"`YbٵZLFvuY~\`wض}A${0vB{2a:ΝPc4+ cenUXnQk%plV-hI*ű {mU/A'PB }ZU*FҜx'J `yi0Y~K| 0+l`_u٥nyGW ,qٲg;L+BE+Yhydtѷ=>:,0r"E*`oN–܂C{LĔi"Rv LcU gm}6AOuO1~Shzc^M葻Џ갧@ 6 fc Bnh ^២v;pĂx ?D3Q װx~^+wP ,מ]Kfq|#l\NkSxŨtx x󯱼hOK؈~3jc6i8kmB/x^yX.LA6X۰Ku9z_o_%h;jt?x j\!Nev݊OY. (ŏu-`vAsHs!A~#|%W"Y^W󜅚u6K;؟?SЗqeЖ^83\%ǰe8r&aoLn"(]&H~GnKpLo@2G| v?o;m{׺S86ïe'Mžp_^).s0molW J<Ά@8q~lN{1tVEm'glTke8߆_ާ> K9ʱҜ:`[{UgLJb-3a&McdDL0й[+)jw7/K ?}9{:'&c56U=Op͵L` a<;d'L L3:s /xC¨O8e J3;ܺE:%wq_fڝh]zGq0]QY\䏮LhO'q<8mQDa?Y_?3Th 0jĻ#PTbpڝj)⭦Ycq$Ģ.]Xbsجh6, fۢ~.d8 q 4UCcDE3wc|Oq6'ƯwU7I`WL~>6G0n&&%j.M%.1Z48ihCX~g׉_yGΏ]XbԤ^O>wҺ!.WA:ki23d>w\ O vt)Â0y18ȸ'$5YNAݺ1=gM_^z"q~M3徍;K>j_yW 5qAeAK$b (֩Â.<3:)Zsh3m͟Xy83C4@(nWA+xqJ8CSQM4lnܼc w '?Dϝrr:X^M. /]_MMWbuY@=6 J7bѭUN0*K VBX:A'Zτr  J^) _P)K}=sV}8k!|X]2wz*STp~YsToB*rCJ?YT晅OP5IXj)daZq;s B6/0<Ϗ0s,VT*ղYW ]rcz0Ʌ~Xbl+udlmZ)lE+k*SZR֖ #m^[,m% RŪ֐˶7TJ}8ꔮA#K v\Kv}O>j{``D)mː%XXjhSl,Ӫ`>OWb`cjUcPiRM 9SZqWQaolƪXX7`?J}[嗲G!|l|ovd+KUbN]%ۿud) njn WةL0 *[Q*}hq:S"CPjH7^KTv93O:ur˷rkSڨ>b|>oT&r,uz)ݯ( N}'cث:C2AUc{گJszY*]Rվ2eUKZ,QJxVRg~>r^LSr=KQjk+Gŕ5ΆʻcAUZ誣#ۙu=v?uZ9/m*5?WT2cEY-k#ƭݾ7ZJjW6-W!vƼUe-UŶ*qעqj=W ,*;{b^U59\rP r-*uz@ZolZF˻mk2V[[CڶZ) m5#Gаf?S ?W!g{'e3 &}S\Ǵ|ȃ!\jmó~5]S5j;_׫QWa`[}NzM+Yaӹ*dgZʦXS~ӶgV9*w4-kY73Ը]LSFЙdKgu$/m֨;^J߲KNpm:MZJS_3Th]Y&{-G̱" R*[j"ff۪ }DTZQ;\*ujg_4 FkM^:5e񰀲QjE >gJ8ڻ+mpfֹTy=:*ڍ~Ue{U-J;TVږnk>Ar|ڮaR/;W,'o ے/6p~ib$Ƌ>sծTi&ψj_q\Կ㋃3Xs SbxbxxSQHs@Y~z?l=z#QB@r^\Gy>Y,P/BT\߇&!Fy[(oGywC}O{Q~Fgx??_cFOgɠS)(O5|1 1tc&ʳQg܂oo5\iTaz Z(2vh@ k7Q>`@q6O7mߘ[-mXa V,dR*$+Z7)^IQ6iI7<= TtIO:VJޒVJޚZSf@yfJ1ʳSf<'e7܄ܔ(ߜr3R%)%(/HY-)Ky/,aYcQgnY1eKLyߓ X=O&O/O9{6L_و={Ps/A ս:ʆb[P.#L}Sx_Be Oz/W_Qa9Nz ~>!x>xzAh Ǣ<.}<קO)25}7H/N0_o h__/W վ՘~o wk}w޷}|o3piv5n(x"Oil0>">Oy1KB^Ϋxk?;nϏo 5? Sg~_MBH1B"1QLb( EX"DNlbxLWExA, _&ݥ'ݧ{Y8 ҇#pO֧oA/ח5zH_{㿋>]ߥ me È1dcFo#` 2#c1}{1Ә#=(5ʍ!cXk7165ۍ{~h`l7^7615~e|`|h3._32ˌ1ͮf1}fe0Cf9֜`N639<,75f\a6ך{Mw-vsc5FeyyKs\TWk+5U*vs*s-uպVVֺ66r=jp=::::zu׻_>p}: e7q'5Lww;ǝ.t's%2w]^^^Ͻ{1.w)>AQ17qI!K̉4'C#w͑;'| u0d OXAugi RA ~a݊ a1»PTɎ. ;LI9u3:%3T Fi2ķע O %/\iR[jm-eJ6>ef, юqj`?USGzwNZd. =څm -`8<˾ugw'HF9ñf|O86gퟯl%zQP"bY3DGQ*!X3AV_h0rDȑ2 /DTz7俗j2t'gۡ3[JWkUw9R({R~Pi9/YĖco.k"g{A_50Bӓ=l,ksx |Nvz3uXDx@<)ē}zhubQNz^ qr}9A~~;Xz@w!<\?xTg^tO7<sgc0XnNh ny0E:c1c1Pd3x $<]N:xҙN7J0`7?k g}6Y߷vnk7k>!ap=-xs"=^\\7d ״* 56`،a+0p1 '0pY 1\p gl;NNɉGl'wi޽]qNĝ8ʼnNę]ϛl+>vc'iveEv5i%jiZi#"mVheZV6hAۧюi'v^]Қcy"O<񑼈Oż*^ |3w ~gy~_M"QL-HQ$bQ"DkYl;p]'c8-Έ⼸(.&cD=MԳ<}^OՋL5}Uߡ7#1~Z?KzaFfdٸʎ4FQbUFWVc`3njiq8o\4.MaƚfifyHȜj%fYe֛k fsl0Gc y< v{gpD{:1;;]H:iqOaAzwuO޳GcܝG1]/1j(q٣Mc5`<50Q_r78OZ7+܎~No4l?aEwa~b_Vv~ertnWwWZRbGTWۏ+{8ąNw^{'w_+QN\XNmWO||-q&1a)8wN<‰c.6G;yYwɼ^5IvE'ٔ|*4?thقܠfdm%ЎkdE!iggg%4kZ鬢YmFVkNugyK>g.͜tN8_9'imڎϠ_%oMkMN-r"_eIXzy:~ηQ|~:'0|[c_IAmkRsL9?aw7p7 ;`~:]3ɧ7NI^DIǜzZ.>rfKC͡3|Hs$IFHryIF>gg)txBѼZ$_a ^i$*W T&Dm=T6D%**G 4/2CtOCCIR)T$C\9yNÝrF;C8gw:w;љHdg2S~|/+]JwbtlUBz~MOH Od%yx+8y+&z8@)(BvS+ n[Q*tYmn1QB_.Fo&oP[Oӝzɞ_Ce=E:H!iIu8B+z~Xy(ɯrד.4 ѵܠtmUʦҫo5ld5Rla]KjW]"n)*7«Rz'{~J) yb bwX#6mb'O qJ,Ql+0<֮5O!sni6/ظ p2/ a>}ݯ|H<_ybJ?ce^VZ/HHHHHHH~zWWK^6 0ڪHk^[%ڪ(VDJ l=AE[A?][jĿGKuFZLaY^VeCR]eO9@t')U}V_g3x!>? //%'Oo.42ˑ_p OqƦ4i-Y˭:bMzy5ZHuHppnd|dUꖡ[nYz1cTMwۇj+ه]q#_-Í7-+8&;(ۧگ`ƿNzIJ'YYcYwd [ڹo{rvNH5zx#mfH[~1J:/?V7JRoMkO\C$MU^C~9Dv- ~'dDr'E!4X 1$ǐޓN,u.r F ^D0!A>!~PlqF"3:5:0cmiM#9kQSF.9TbWg6ros俪0_U6K]TS,u)9;bMr|nbw7.%cZr5"Rcok5Ύ?:#@tN gf ג~ſ\X'xW;q/::qb C(c:P4fyɚ{qIkO@)D)w/ kFB(ŷ2{![ QCzޗ1tFB]HOp@!zEAJ#8>>t;<]̡8t=Sƚ;9=1}$=3QJ@uؐ(..B5(n,KDN }乕˧R^=q2?7=̮WyuUحnuvؽ~/SxmnCvVcK*MSkS׊Z^#ۅݮ^n7QTr)b7}B{+yfY&>6MSgjX9քSEEU|o:MZ"'ez w{"l3=ã d\foFrF5Q@+fWWitG*UT_x굫wvJܺdz)٧v;TG5Ѩm&68fg[X-2[vo:smҵvo.݈Oد֎:N:tב9ηl^mT75d䵷jfW3cD9{=caeO+ K+k[{{)cSo^I͡f9cXcv?{=b#x{=ŞfOg3Y#\{^l/Wkf{i)GSIFJ9^QjRjq{wjhjB竩Gpcdeܵl065Wy캌n G٣q{=7۞c?aϷK{bowػ=t}t}K!UnWxtT+hjJjF9|j&Glk]Z^ YQ-Y Wz},> !I_y>Cq5ǬA,,AI3ZL[8*SEX+YuK=n,`NlTZGG|d#&SSt0e:L3YFzz^B$y>:o:}{@\&meFZVLr%xEaiJ5l}ʭжCn ȂR }zb}A3@0r&5Wq:{88^6q3?(1P|gSGwbhY۞;d,z6+Ca_wR7lW{LϜ 3ZUجw{5]fUF)ag\~zu:͞f/wjIup۳Sh0W,&]ŧd ~,)eYYM֑Me[Ur r\"-r'c[3[Q*SPF <( *]* **UUU. sh#yUUUUGMeD@z6jPĽY6>Fh@ԔI Ӽ$+jN9 W䷅+S3MD\m>ܜyC1_Roj]) Px=ك<ٮ[Nbh.3)2,3e Y_dwOɱr!r(X9e*Me*jZS T#x5UROjڬv:QgT~ )P*فv^NP{uNΠPPWn@A7zn   t?h hP.h0hVPh8hh$h,NTt(mѠ1A@wƃM  t/h> LЃY@ACAØ1Ԣ_.TmF=]%#GAs@=z4h>iB"3ŠgAK@oVVV\9Z Zzh-hh=hhfˠ@oz  h;UN]7@A{@{Ao:zc[p!#ǠO@>}:t%+Iנo@} t wi6=Џ3@?~ : ;P><'@@2A(J]*TtrzP'TJlPd]hx.Eov4 şlh.ZRj 73tzx1>R}̴ g,zp!ϴ2RxswGiv`l*/{7^/&9皷;ϛ/i}.}͙λ|LwD ԓ#ns׽s;zXryWrn##>O87&g\9zs_rI{ݿRc>e !=η|Ꮎo!B]NO POKU]*ԟCd&{yo>4wXtoT#;1<˟;9YR?C=Oe|ߓ7YK^%ѐ,~4Osw,LB씡W'/#Asu OIbX,- $GXX DZsR8&qLNO:?;w&X_xrDũeh|/΅C99_449 \ =b U ﵡ@usߍҖwҢek9DΔkiyF:ިW|,իN4F?42YkTdJ UX2kTej YQ5d WFM֨4լQ54F=h 4F#hM4F3h-4Z5q-kNhmXkOױFG蔠Y ktM׳ =Ak7FO֐2c 5{[qM;z;U F<qmnURin4i2[OJZjH`_$ue^r{ t܃^RynEJi{)jD6jU1˓mNk[}m 'iK+:[V'O[4험"M}NlHJ$ !'#^ફrVz_?^ha}Yc4'_?Ns4'[BWO omٙ_@z]ȣA@_#G2A(zQIf T3Q/L?Puɖ?NY+ɫȆj%;r&)ԓΕ*oETfdEZVVVVր) &]=!+Ttb Y)dPiP (r/A!rAam YE c_/.-k({to֍LIG57ڞ"iV6'iqN4L-#{ʁָ!CF*IR*TjګnFjzDWzUR{:&gSP3PsP PK5VkAAm@mA@Aׁ::::r@]@]A׃nuj t3 PYPEP5ՠ P9PyPP&2 *:( t%&*P-PmPP]P6>!1nGYTỌ[č%.5ǔֵѶG}00߳.ϩI)ޅZ]7RkK֖kq$۴)l+ZDZbXw 4E4r-@wvyPw;tG1Xvw{;޽ӝNw'SܻIT^w{{;ٽߝ>ttg݇GG9c\q Iw;}].tR5>nomU g}u /tOo=E HcZ䈞b!ƋԛFi1mm=z @Ś=ɳ,,a>RbNEh+e6+^n UB#Fw>kH7tj+x!rEuۭFiHNCqҠ]̵3VWV[[?w;_8U6lwe*]{κi7M[w@o:zt0CGA>}: t 8K WA߀ӠA?~ahRg-,/u?3nuX]g/t=p:_@a  @AP(8P Х@@AA)TPB0(ʀ2@Wʂʁʃ*2AA@AU@UA@AY+A5@5AWjjeˤu.}Zlզ9ѮaRuPU?ƪIjjڦvcuBVFD -%= t ZPkPP[P;P{uNΠPPWn@A7zn  44     444t;hxН @Aw&&z0ip8ORJ6-Y駨e/nYSpM4h&A,C٠A= zIe=%{,TlCIe^Tb*xI2&w'/Ų4%@o=Qڸzt%4s?35=r9{Rψ,'X[zt]G-z< ߪǞ(=qK^ŕ+JBw\V4)\'"B>Q:hV}POJ& \g4xi~nA7nug*hڲ_ !9]\H]i!mB9 i!pH҂CDž4r t37nysܻh$_A*_A*p5=a;ìapWc_NE߂&"h;hG}2ݖ'tݻ.Aځe=(~$_K/%; V8Fq,X|}&e("!"^$S$!~f[>v8e=<9/N*N e9wC#wGeؚwh^c*ۇ; -*'g {i*[PȮۡ@o,s=[=潳=^ӭ̺UX*Vgظơz~c'ĎpxcP#5dqUFX- 땵eaj-W[|B?p?rg84sC84~4~4r&hcXw#A#5YE&Cq>aaF5XHFQ(Y YRF ָ5Je CYck g^}dQ/xfx9Y\el-{(7tL"'’{|,'ƒXR`KR ֈ|3YO2%$YOKIc\q|<,`¸//g}KX'YƒqW{Y!8D:M= WV>?Nwb|gDѻl{&BYW]pE֐߻bD zh?]{A@>} SgA@_}:  oL^s?߆w7{:uD٣J.]JRAi   "( (t,<(TT TTTT Tt7hw ]毼^׾R_S{Ǿ,cLƀƂydFDދ|j}:|޼͢<\OH}HRp|E9_'YOd=|;[m|(x(SGNG1r&S/_#"E~ɏh jDͨ FEEŢţD'FTc uQ?9[,VoE> [nԊS;!yRSUXe*G Pct5/6Dk҈v&'%9>I-tIjOr5KI갤OR%7$,cɍ>I}I&!Kz$XrOҘ%|&,4eIK$Y'i>IK Ia->I+ Ie 5Kr}6,%gUi~ܢ]xHBȗ"Hwwwwww69g333mսv?_$C"1HH/)!/ Zۍ$J+cvVk|>kn˶.j]Ǔ(CeGtۏi<V?L?z{O;Wuo_{lEou5m~ٯ᯴%˔mu緽UJ [,~W)QMy pnxO~@AA DhbAAHI Tt:Ld9 ]AtAzb`@ p  hPzޠ `` ` F`  Ɓ`&` ` f` `X` X `X V` X ց`6` ` v` 88 8 NRpg9p\%p\W5p7-pw=p<#<O3/+o;|'|_7?aXaXVaXVa XւaXփa6ư l l [Zm`[h 4fZAkhm:Ag]tzAo}0`Ca{aQ0XxaL)0vi0fN0vYasaWa,`wX{!H!J% p pGp p'p pgp pp\ p\Wp\ p\7p pwp p< <O,xx^x^ xނxރ>> ~~AeQ9TU@Q%TUAUQ5T@5Q-TAuQ=T5@ Q#jjZjڠ#d̐9j,%B";d#rB"7<'B"?P B(( P4AC(%$RP*P:@P&ꌲe墮(T@=Q1"0""8H"4*APoEP4 D`4 Ep4Dh4Ex4MDd4MEt4Dl4E|-Db-ErDjEzmDfmEvDnE~tDatEqtDP):Π:.nzz^zޠz>~ .+ʸ kڸnpc7psĭpkF`Slq;l-6a{v.aw=>aq!8a8GHq p 8'dSqGq3qg 8.8wy8B wE1#13̱+q {>/x !x(x$G1x, x"')x*x&g9x.x!^%x)^Vlyt6m<m3w۠0274J0J5dDFW]7mGƕ7kv۽/gebji_dþ~@!CﶿoC#oHtUn;ѥK= e.G\^|rZuE7\UpV-mdnκu{^޽{ &fV)] ݱ@w_}w?(QɣGGGG(1c{P ؠ 42h{AGN0Q}pFp- ~BƆL Y?@Hi t\%BﶯվaCG?vXamÒR @Xa+ 4)<7 ,FD(q1R͈"Gl"edL$0rUc#OE*eţFݎ]!ethtLtbtR4>8& &*KL)1c,Ys.cm}g,eb.{Cƕ KKˊˎ'z 7>nQq?ǛĻw6zBZ M%X%04aXˆ 'ItNK O잸)qkRaRIR>I%=Hz\!<9JNM6+mKѴҴMҧ/M_2h33233:fdP3f 1:c\ƌy3d,ؖq84FN;ӗ*.ᙩL9,sR:w˪(yg֜Y ~C!ۀ 0000000000ϰذİܰ°Ұʰڰưְð۰pppPj8m`lbfnickgxjxixexcdfn]!Rvճkdʮ]/~Ck{vl?{x+9r#(>$>Ki|y|_ėe|_u|~~_~~?_!eI9RT I%RT!UI5R 5I-R!uI=R4 I#iLiNZiJڐĈĄ3bN bI5!ĎH3q!čI7! @I &!$'a$DHEI %H' $$dBRIGFID2IgE $.$t%y$Bҍt'EI !0‰ (I (&Ho҇#2  &CP2 '#H2&cX2'D2L&ST2L 3,l2%|PBdYLdYNVd%YEV5d-YG֓ d#D6-d+Gd;Av]d7C}d?9@C09Bc89ANS&gYr'Er\&WUr\'7Mr&w]r'C0<"<# 0$k%x| '0|&_W|'?d򓖡ei9ZVi%ZVUi5Z֠5i-0֦uh]Z̤iڐ6ƴ mJ`mҖmMжԈSjJͨ9mG-%ԆR;jO#uԅR7N='ԇR?Oh 44Ih44&$LSh*Hh:͠h&LfڅҮ4ZH`?-iړS@!ESB)eSA%UTڋ}h_ڏg:::::N:N :΢:Σ.. ߊ]KtH7t JtIwtK=H=J=IORzg9z^%z^W5zޠ7-zޡw=z>#>O3/aYo[G~_W~?OVeXyVUdXeVUeXuVd`VauY=V5` Y#k̚kZkڰ̈Úf3c`̊Y3f=s`̉93ܘ;M'ḃ2?X b,,,E(bX,X/Y6 d`6ڱlFlưl&ЉMb¦il:fYl6yl>[El1[–el9[VUl5[ֲul=6Ml3=Vmg;Nf{^g/;;ʎ;NRvag9v]`%v]aW5v`7-vaw=v=`#=aO3`/+ao;}`'}a_7ž'/r<+J2«j:kZ6z>oF&)oƛ%o[60FܘpSna o-`:Vܚp[nwN0]+w܃{r/ s~ܟ@Xăx0,!>h>#H>cX>D>OST>O3L>s\> B/KR/+JkZFo[Vo;N~L~q~)^O3,? "/+*Ư&o;.!')Ɵ%_7-#?/+ƿ(#ʊrp(/*,\&%j:'ph(DcD4DsBDkFFXSa&E;a!,6V { p.U]xO%~n"P`"BE{&EQ"ZĈXAĉx EH)"Uti"]dN"StY E'\U|Q E7](@@DPBH%-/b,b.Fb<.F1b'Ƌ b$&R1ELt13,xAs\1^P,T, RVx[lfElvC[*}b8 C0|&8&8%JiqFyqA\eqE\uqCmqG}@<~OSL</KJo[NGI|_WM|?OYFdyYAVdeYEVduYC֔dmYG֕d}@6Ded#l,Ȧll%[64DJ3TIvBZJ+i-mA:J',]tCzJ/-}2@ ,Cdl/d2JF+;8/dL2Eʎ2M If2Kd̑]d*d,.dSZH(ĿUhI$Lr)JjP^#~ Ar"ar!GQr#qr 'Ir"irZʙr-ȹr/ȅr\,ȥr\.Wȕr\-ȵr\/7ȍr,ȭr.wȝr-Ƚr/ȃ<,ȣ<.Oȓ,yVyQ^yU^Cv!o[#"GyOޗCH>OSL>/KJo[NGI~_WM~?OUFUTyUAUTTeUEUUTuUCTTmUGUT}@5T?jfjZVj*#eL2C\SRYZ([e앃rTNY(WܕT^+ P(B`BU{TP*JE:8TJR*E*M Ie*KTQ]TT*PꮊTS+B +b+RJKV}T_OW@5H VCP5L W#H5JVcX5NWD5IMVST5MMW3L5KVs\5OW BH-VKRL-W+JJVkZNWFImV[VMmW;NKV{^OWAuHVGQuLW'IuJ:Ωꂺ.ꊺꆺnꎺzzz^zީ>貺.+芺誺k蚺躺膺G7MtSL7G@-u+Zm6&TisN[hKmv^; v.Uiw=>Wiu!:Ta:\GHut:^'DuNuNԝu6l\U|] u7].@C4DS4BK%辺zzzG1z z')zzg9zz^%z^z^W5z^ zޤ7-zަzޥw=zާ>#>>Ki}Fy}A_ԗe}E_u}CԷm}G}@?ԏcD?sBԯkF{AԟgEwC,)SR\I %K*T.RRZI%5Kj.SR^I% K0|huo a$@ $pGZq{=[{U{׽W[SomZ6-hڃ#:xl AH) @ dL R rJjZz`Y #03yH@7/(E(eDA =A/U@# `g0 p0h0/`<&I`2i`:fYW0s<0, ",K2+*k:6` `v` `8\G1{o88NSETmg8. n w]pC<OS </K 7|+kZ6q.a6al l [ְ l ;0 r`Da L<@>L(P0Jʠ*j`̆9M sa@kh N$zB~H"X K`aa2Xv`wVž *X ~?OpB1d`3ap8GQp4q8N$8NS48΀3,+ pp\ p\Wp\ p\F n[V n;N {^AxGQx $<O?x /  omxޅ}>c>sk7|o;~'~_Q&j:軪(E>jF1j~@MQ3ԼjZV5jڢv}GuDPgX8(qQ"JB("JC]# $Bb$HZ]ɐ)iPF9ȈLȌrQ +|dGr 'r!Qȍ<ȋ P!!?Q*F%(((JQ*GQTn;*QO F}PF}Q?'4B1h0 AC04@#(4Ac8 &hhfhFs\4G B-FKR -G+J FkZG h#ڄ6-h+چh'څv=h/ڇ :#(:~G tB :Dyt]Det]EutD_6{>zG=AO3&K F7C}B5q-\8\nƸ 7psĭpkܦp{wĝpgY98sq"N8bN]0c ,b%XeXXUX5XuX 8 gl&lƹ8[p>c;0)˱ӸAa (]q7'{> W㾸@U3x0C0<#(<c8 'xxgTWxs\< B/KRz ^Wx^x^_ oxވ7x ފxމwxދ>>q|ħi>?9|_%|_W5|7-~\=?O3/+[G _WSf01qL]=Si4d1&LSӜidZ16L[Ӟtd:1xŰpD&IfRTǤ1]>!1H)#c䌂Q2*Fh-cbȘ31ؘ|q2.d(x/S2>LS̔0&Ȅ0aJ22LWӝT2=^LoST3}~LGf32 f~f0Capf3Ōf0cq/xf3Lf0Si5UO5~N=ğ=.)+bY%bY1dXjJYY}X5555uuuuuu݈݀ݜbsIvŽ8l?݃ݓ ?G'ggWW׳777Oϰϱ//r4ts8dN GQq,Pz HXxDdBβK99sssM)!> L't 9 *5[B\2᷄ 'K8p7Q“ܚV6xkڹnFen13ww$w ww*w6ww%w w-w=w+ww$&!) kb:q',L?%ĕ[w$Lܗx8TķI5I☏1$ٓIUIF'M4%iNΤ]I$ə{IO^%On$7E#I&˓ɡ>C'I yq-ɻ'|%RꦴLQS,)D3œRO)I DS*R*SLM2+e^ʊ)Rn6HmNMO:SSM:9ujԥ[SwI=z)VR>Mkkkcx.1#)x<1zooooo 0,7sww9YZiiii4}Z^-J+L K1m`ڠiiKҖH[%@鴋ioާ} o.]zveRE]v9^]'j[[[;$~2? /g|5_7b7v|* C2~w~~Ϙ0WO__I>szf4sb<_?14%}Foiq7_NHӿ Z @.P 6+ ~14^0WRCOpPpHp\pFpVpMp[pGLBRXWX_@PH\JVI )B0])B0[#4 MB:y #¨B-fz { {  &~.....nnn. $"RO_3jdeh*uF A:#;Üa9n3dX6cCƌm2Ngq#IƳUی6"(UeE&UEe1y5A4K4[PLIYt^tAtItYtEtMtGt_DR.KY\K\[\G8NVQYK2Bzq8W{b/aQ1q)i1ѵVUSW/&Nϋ//gȬ,Mf|fBfb2Stgz3}̮155sZ]G3eϼOw$$\ _.HD"Jd&qI(I$","-Y,Y!Y'(,.!/9!&/y.GNEZWZO&"IRT%UK<)!uII[Z iHZ&J+ҁR q҉%ҕߤۤG'ץwwOOoe5c>,^Ɨ dBefEf2%#ePRYlllllllll7~AEuSk߲7/8ysyygyUT~)ڪ:8U=USUJPxtDSeTʩ*VzƪƫVV֪T9}3 uusuuuGugu:]TIP;~y#s+k55555-54 F1h5FMƢ5j"M@Ԅ4ML3@4S55s555_5i[j[ik;hYZV5iZ֥%AmX[j+=@ [{cv}Luu%:NYtvOЅuer]w]2C:ctCuu#uKu+uuktkuutt;ut{uuuGtGugttbO|P/:}>WoBOԇa@=c`04|:z6^IiMm=}C#C]CC#CCSCkCg 7 `78 NC!l(3Tz* } c &ff4j&!M}ëTd1kxִYKeZ6kcŬYwk%fdٺl[6.e+f=6{V;wg>},qϲ_i$#̑99ʜ9sFY!f,O͹s#VWcMccoTF*f0'77wwO/__ZژڙL|a$&IkқLe44444444ߴд̴´Ѵttt%&=;s9͜af`6fl53iv ~s2ers1602153bfae^j^m^c^k^gͼѼɼۼ|||||||5fnMs[Ƽ)7͝sVŹsGɝ:wMCs=(EG%OgsJy73o^ކy{>XZY[:Z-lK%Œa[r-yRl YYZRFV6 ˩[ܱܵܳ<<?4J[?2Tײ|.K:n[{^ie!a1qI)Y9%1ݻ¾ƾ־ξ;ݾӾ˾۾׾~~~~O95u ]#cS K+[{gQE#D'M~ gJBE %t" #a"r' 9JgOgqwsNpNtNvp.t.v.qnvqs^ruw>t>u~qtŹZZZڹڻخ$W+Օ.K撻T.Kһ\.hWU*\\]}\U.BaQѮIɮ%m]#sˮk\]w\޸>>5d]=٘lB6%ɶd'2L!ydNfRRFjIMVFvAR%dYNFd%ٛnL Gcr9I!+Ujr-Fn'ȃ!0y>wprqsptrvyy4tp<x,cy,|Cxx=BS)Db~gggggggggggggggggggg/=}σ7$&[{z;y;{o7󊼙^W{5^͍y~[-n>*oޡޑ1ޱ)euޓޫFA # = T0`BԂis (8Tpd <(xUi!PS[Wh/tR1 g.*\]p]ƒ o{>*|Ym¯:8_C_#_c־v>K%>O>BW>7777777777777߷ķԷʷշww80]===}}77\_v??????ɷbwi9 M-m#SsK+;G'gW]Eס ts݊nOwivH鴀ΠEΤ%ZZOi mit!+tw]I{}j/=D#|{3_Dz +=^@/;5VkfzGOЧ5:}O?7#ZT(aQ&Emu,bEE)E'N]);>^|},'K59bgqAqIq(Y 2`LL 83p.p5"2:`fPTAMP#=_ooʌ؋27 0()׃77)OOσw }*?ƎV֡NPfH҆L ],CKC;BCCBCWBWCBBwCC/CBޅއ>kkuMímì0/, Ê2kºpV8;7\9<9<+-}^}Ye 5.?|M ; ~9JGI##&EL bUĺ"DO!"c"GGH)#EtqfuptsJY՜ --Ȭ>ξh'p"'vR'w tNr.pvnws^u^strwrvqs~t~cG%J+*oT\Z(hM3˚ښaʹfYC˚c͵YBkQ&k/k+/kZsZeY Fk9昵jmevƜvYgXc.[bZi0Hmu,uNX'cYb[ XgcY1ϭ 1/֥WeĬ+ՐY׭͐nY;]u?zzd=XOgszNh6zcIf>XOgw KTn~Z N ;H qf f H R H ҁ 2{2,\ + 'r< /G@APE@QP w%ڃ(( ʸKR(*ˀ .j ꀺQAX@wu]42r 4M@Ӑ_@s"7h Z֠ h ځ::.+n 'e7@n`  n |6`w_"@$p( x! q ֘80t;(0X  BVHq`  ƅ&` &)`* fGf``X -ب:ĸ:, : kZ-zl=lۣ<` v `w{*8#(8QAp3p=p\p\ pp=н<F')x%x^7e-xރ{>/+~ 0L0 L 0L S0 LkL 0#3,0{3FœQ悹aacaAXvE`QX %`IX ve`YXaEX}VUUa5X} ր5a-X}ցu'`=X6p a# acĘB6a -mܗa[w_0ݷ`'vq߆]a7}=`/}ߘC;82vCP8 aÍD0:&(0zݟ`NA GՉp$GC˓!1$B9PzRB5chg=! h([<[Qg;yv gg/rp"E!g6x!7 ȇF?ƅXy4sDEPd!2"0"zn#8Hz"ό"<4C~{^ fB=o$4MAS44@3C26AsѼ+E0dK"o<-AK2G+CBobCm SٛmA[i6=OBCt yTWJt؈TtĘTtC tBЙ?BOEg]9t]@]%t[ ]@W5oit[@7-t[Aw=#V}=DBj=VCOS\E GCч}6Eg}EwGo pBo''IpR̘V)q*iq:gq&g1gpvĹpnp|pA\kDžqpq\ĥpio$.r<+J2Uq5\5q-\q]\q7A7f9n[1[,n*,ne,;z93z%7½q;<ƒD<[<;a؆؁ýpDHl4Ga.1Fb7`/a?ࠑ8ֻ#(<[xWcu`X`8c8<O[$<OqS4<ݻ3,<s<</ "#vb~/\ur{ ] kZigF{o^[V^^;.u{>!|G1c{q|ħB6g9#}ys|H_|_2_WU| _~7Mg| ~w]7|C#?_4$3/+o{_F 4"Ÿ}YƿoW'I<& BR$$vu'I^$%Hr%Hj_yU &]Id" &Y|5HV_MWd'9HNW&yH^'HAcI!"()kB$)EJ2)O*l1BsLڑIjwLj:Ǥ.Gn!id 2i2Ȥ_Lf9iDZV5icD2i낤qɤF:#D:..LI7ҝE>'"I7I?'@2 &CP #IQa3 7DH$QEI q,!^3II,AFQd4|} HgB%Xg‰ y&đ1d,GƓ d"H&&)d*Fd&Ef9d.Nd!YDf%d)YFd%YEV5do6YG֓ yd#D6-d+Fd'[Fv=d/G 9[A#o 9Fu$9EN3,9HΓ "D.+FnoMIuMG1yBg9yA^W5yCw=@>O3bd6Jg'E~x4>M;ND41MBdS49MAST45Mc6MK44424J[44'Es<4/G)-D "FxӢ-NKВ-Mв-o7@+J2BjF괆IkھϴnȂz~ȃ!m"6MhSi3ڜp--C6mmi;޵vgi'ڙv]i7vݟ=i/ڛ}i?ڟ0n`a:_pFmאS 4:iDi uRkD9Q? Р#H:kRD1%RoD9TQE5c7c8xc:N:N cL:Φs\:Χ F "O.K2+*k}:ߟn&?nq[6;.{>\azGQ=NOГEO3,=珡z^C^Wz^7m7mmzޥ}?C>OS?so[ί{~cg~wog XB%6%aIY2ܸxdXjOe錑gYebYLes]dYӸy+$Yn?eX~eV/dXa"V/aXqVxzV`YVcYVUrbYVUcY VbkYVcY֐5b[X֔5cY ҿbY֖3fǬ z:ϺϺn;z^ެzllzɆ,,$ٙi>sϱ(b,yYY,aT?FbA5fQgIfqF1{l,Ƴ l!&)l*ʦl&f9lnh`l![?%l)[Ɩf`+*dk:m`&ma[6$`;. $b{پ@@2`!vaG1va')vag9v]d`%v]aW5v`7-vaw=v=`#=aO3`/+ao;}`'}a_7`?/NjNr"0̜Gs9 L80N39<:\r5 cX>D>OST>߲|&g >J//ͿW|U`=_|_7|̷oϓo;N{^A~Gcs8?O t*?sl~_m~_ ~}~ m>G1xYsk{;woO DBH$IDRL$)DJJiDZNDFIdYDVMd9DNKyD^ODAQHEDQQL%DIQJeDYQNDEQITUD`*QMT5DMQKuD]QLh MB4E3Jh&ZUhEGm$<(<*<)O<+(/*EuyCޔmyGޕ}@>cD>sBkF{A~gE~wCXOW TBH%VITRL%W)T*JF*J2*ʬ*ʮr*ʭ*ʯ **J*ʨ**jV,SQm:{)QuU=U_5P U#X5QMU3~::N:NS:N:N3:ά:ήs:έ:ί 肺.袺.K蒺.貺.+芺誺k蚺躺膺n覺n[薺n趺n;莺论{螺辺zzôM۵C:Jtn^~AGz- 4HcM4Ls-Jkz'zS4=]3,=[s<=_/ "X/K2\+*Zk:^o&Yo[6];.[{>_!}XG1}\')}Zg9}^_%}Y_W5}]7-}[w=}_?#X?O3\/+Zo;^'Y_7]?/;.^\q %K4.Y\q)RťK F;õMƥFKá[#ۆpݐ{6ewG4(ʂr<TA%PTUA5P5A-Pāx  @ A)9P%P5-H)@ 0 HvNn@^ |z>hF1hf9hZV5hڂvGtA't]A7d'z>/` !`(%Fl!000L`@ Lt0l0|,b,rjzlflOgn~papc8')pg9p\%p\W5p7o D{Tw=p<>Gqy<d_ϲ/x ^MuG' |s|Z=0 e?a쇰 , "(,g?%`IX e`YX~ `EX VUf?Uj:kZ6P&$(R(r~ PP09jzhF Ӡ Z?ALvNBFu }@N?9J+!lG 6`s"X քr A-l &U`Gv`vք`w4'{>o088 Qg`FH8 `qQq`NCprS "!285N 8΂8΃.. nnOgew`]x0  vYHT5F<_')x:*3+\8bT9Uexo^ע [6\wk=x?Q>=r#> OYp/|_#| ](|?Ϩ g~ EyP^/xGPATFEP%T G%PIT ^EePuT.x BQT UFUPըj(#Q8%_$$ AR$Cr@J EjAڨQ !}/d~BҐ Y-#;r 'r!w(/P5e"_T^B~ @uB%9EPP%5BQ4T5CQ BQ UC?CgBC5Q'uA]Q7eZ'z>/jh c8!104IQ6  F!Ƣq!&h B#(bh*h&f9h.h!Z%h)Zh%ZV5h-Zև hCȈ6Mh3ڂmQ) mG?Lg#*FhWԌB7dG~tQ!toA  ~AG1tN:Π:.n7t Fw.!z')=C BCBg}yp^pA\EpQ\ %pI\ epY\ "+**&k8E8q"N,2, *84lflVl؎؉] ؍=8# p&c?:Cuq=\7 q#8 7Mq3-q+mq;#n;ஸp½q<ƒ<88GQx4qx<'Ix2a xgxxx^x^Wx^x^7xތmx{Կ?3»C|‡Kc85Xd>O3,> "e|_yu| ÿ[6*Zn!~XZI4~sįk?OWŸg%yH^'HAR&EHQR'%HIR&eHYR' h'HERT'**Ff8 KIą$H$$ QQDC$9%)d#zb FJ҈X:b#NI\ĝy BF$H=%HEa7iDG/҄4Z_Y84'-HK*'iUH[ҎOڇ#D:.Qt_[T"I1[Gғ"Iҗ w$209ܕ "ɐp24jadx/A Px0 Hx(IFd ]P8LƑQL`d"D&)H'DXT #SÈL# 23Yd6CydYHid YJ9YAVUd5YC֒ud=@6Md3Bmd;LvdMdOPx!9^D_KѨ:FWWr &kir%\ ɥ2B7kzx An-r!OyL<'/K&o['G'|"yi>i!ZEi1Z%i)Zei9Z~G+ЊLЪNkКMh<*4Jʨ*j&zjFJӨZS;uP'uQ7 *P/ͤ>Z~Oui=Z6 i#ژ6Mi6-hS*GJiFvGڞvoi'ڙv]i7ڝfg=E{>o#G?':CP:#"yhv$? P IGt KtH't RD1%RFit:AgYt6CyQΏ "%H)(Q.lt)]FteFWEtM]KtH7t J'3Aw]t7C}t?=@C0=BG1zJOГTDAO3,=GGTBDM/K LЫNoЛdI;K}HE1}BF 􏈑>F%}E_7-}G#3bO3B<,/ + "hŊ+JEܑ Vae#^V.cwJ:2ªj:jFgXm♈%01KdIL¤LLLԑLiĴ,033TLQw#-Y3;s0's17 &DZ3/阏Ya߳X]Vg XH(Ա9JkšFf9kZV5kڲvG֞u`Y'֙ua]Y7֝e'z>QˎeX`6 ajdžlFld!EH6fcX6gD6MfS`!a16Mc 6b6c02-b>[R,jlEd [lUcjyl=6ylۜ'oUQ\͛_{I^_{7~/ +W6\\^:5k2u\.q]7".(7ŭoq/^ǽ/3{GgGGŏߔxOYķ(~qƷ)'X\Jߊ/~㿊 Jʊ*Ƥ>1"H>7<"hhhhwEAQH4{~0&---mw;7DEEODOE^^^^ވމ>>~}P3!.A@{ ބ &4Oh&}BDŽn z$J0>aR@b2ք= {'eTp3n |2uDŽO yyąťeeXU\[,'&M{> "@PqH<2 ,8_@DB*W3*>k "RnA!a%e5#k_bjJҠ+=JA)W$*='9D9T9\QVUj&fO]#ʳʋK\֜,**/y:''*CkP6UQ9UTUTYܣ/r7"eX*xdVB,<|rZ:&f6O=ܯzzz12: -k"ZQ]jگnn޹eH=R=J=Z=N=ۗL=5׾\^^_PVVU_T_m]7ɧ))))))Ý̪D#(4JƘiӤkƥqk7fhiiiiiiiiiU1 \֜YYYYY٤ƝͿͫgWךOBڢf)mm9.oVV?f 7Z֬hZF1Gm{mmGmbs9cU>>վ~鞅$H.\*|w13)YJNK6%[dW;9#lI<*yL)hz0L䫹ɟZ5ZJ SRRRSS)'A3R4HiAL2&eb\!tIʪ\ ݕ;e_ʁ)! u Z\WBWZWFWEW-5P.]g9tN+~]=]C]c]\Mnnn. FFK:.ԭЭӭmmm^n;G.+ۺ7OϺ<|"2r\&٤ >is} }+~Swwwg{~~rt~~~~~~_L/=?]_ɴ! 6$jH71icCC'CC7CN#8oiXhXdXbXj`dlbjfٰðǰpW IU Cc3s ~6|1|5305342F729Fښ]]݌8888 r9.U5dsXiv3~sscss3sKs+ssۘ <<4XxD$30CŲx ͋[{̇̿qAwcϖcKg\ "gST:Ι49m v;΀NLnlllll!9999[(d甘)<99999˹-ʹ޹չ͹ss 7:qw#˺ʹʻ*\qcW+WoWW?W55M<׵+cBF^iem=C#Q]8'n[ָΝ6vt݂;]/&rOqC7rOurvuopoqoso\7Ec+O~O!OO1O O)'z<֓1xTcx=O}"t<=S<333+==[<[=<{<=AH,B`O+ M.d =B/77 @a0X&BH #Qha0V L& S @qݙ SiL< aHX,, +FaK-.Kτ7?h7tf]?X]ݼY^\ zCi\]]]]]DonnVv~1\3wzoc!]$xfJU2kdt } 3d6t]32rWz@0.Kɜ91fL95sVLoܞ;&Mʼy/!_eWWWWWWWW ܧ)}Zg>sLV־N.1:CY\;??4k?ٟ\պe̷xD?Ooooa_ v@@w*1v@H:.%&c;΀l솁&Vvށ!a``t`|h`v`~`7j\=׳..~<< PwQMlzUAPX)+bKN d2IHOP6<ذQ "wQ˜E{bTfMY3m4gZR6L;==ӑّtfvbvf0]nLwf+ӧ5uۗ b3CTw8sʌf013G0cL&fr1x3L SƔ3LSM%v뙤1{<3͘=fd.e.c`xg62o13_12?X,k˙duauezYA`fL汄,`iIiɬtVk+ac-f屖Yu"vV1 2*&mv`;;;]>v(ʎfcdaes|vgl);-g:v*{ {:͞ɞmS2*G|oķ-MI.s-V\kc~=ׁur=]^\onWcyOcQn-8====ϽĽ̽ʽm^4??3-+pr]7J kp.0JDW*c*: $T`L&S@0fse Xl " l;R`7(*J`?PjqNQꗀU&p 1&?/&5 >owAS 4-@K uW vA_7Cp0ׇ @DA B0LE J@)(V`ρKU^oR9w3|6f= :dB搅1u\ W r<.PO CP @P "!P(b(h44kL}  B  @2(RBjH Ҙ4P>m T-T.vh*BƄAt:&)Si,tJ]n@7[mt=BϠ %?B?Зքy[aG#žp ^p 38 82cap8e̡gl ,z),ʡOép< Op gQ9p.<΃K*x5\vx' .~|> p=| >5hɪ#5b!%b!H;8!HgqCx!]nB|?$ D`$E!tHd0EX \@@B`E0xD 2$#JDh-GH$ IFRH*2IC&")$ dd!Ld62A! \d?rBCaRE!q9#Yr\B.#אF:r A!)yD^!;=ؒ|GMPS 5G-Q+GPg @=.=^/h  4G04F`4 Ơё_2!Fc.?T6?Q2T*h*:MC'Sit4@lt:EsyT4].EJt]эTB%oGwh݋>*ZV5 $z =G/K:zC'S9}67h3}?_1fcf`Xs:bN3`n;yݱX/󣔀, ‚1Rf@ Ć`X 6 b)?`,X`\ @ ` P xFY@aSPƀbzĒ(m`aIdl*6 cYX66(PA.6[-ƖQJ,ۈm "یmŶa۱NlVa=X9VUbXVcG(VX=v;aKeHw={JMk ֌c'[)Qځo(DǍR?NK7%. Eqqv+2zgMG>Cgϒgų:x< χ׃ xH`Pp(@yby)Td^/777[[[+i5Jyeݼ !^ (wWk]]]OCwo"Q!0p>>ȇq|/Fƨ4LO5J ,JkcQ6QnfV6N~R5FˡooVvX lJ}ahH B HrB@' HA Y"'/HLLLLLL 23YlLl\<5#6M#T ՂÔqLpU@7($a%?$ #~#JBO"!.$T(*~K  ao<r JjZapp/Nn^aeOV 5cza(nE'§gK)P6-NF!1TxQRO|^V_">!$%W?GĿwFÂ```>CB7JM0 a`BQ`&m!I')bF¬ 9 mE%]D&"KFd'rx_| x>LsqqpOU$>OŧYx6_/WF/K(c^ƏG)渄_=>頔@cx%İPbB,K2BŤ8I,N'3ę,L,l\<ETBRJZF/^תy7wK{ŇGqq("-D)('*Dq%u) q@\"׈-.qxH<"/WDL| ('Tb)XKK:H%%Ng qtxKI|%~IoI$P$ 0$>FK$D$C$C%є)2B+)#+aRWH 1)gd$OLJZV/)llܑr!I/MJZJ)A($uI=ݤݥä)#'MRT'K'HJ3ٔV2+Y',%-H)VaFVIL:\d2OYG]SK'e Yll,L6H! EFʸy'˄VD!ȴ2,E6^6I)˒͒͑d+edekddrYeʎdgdWdWeewdOeύ^DZiYy5=roW"-G<L'SC6sKy_cŅRV|Z@CJi+)oe"ZF\\QJBPPZU6 J_Y(PlWT*(*5:ETrMq]qSqߨR4)>(T|QҔtJQPz)}=~F%F9\9B (A%Ĕ<%_)P XI(%JRLTʕ*ZQjze2ETf)g+(s~+K[cҠ)ЃzXVGWzROOOOOOէ3|}~~~H_/oo%vd4 ;ٓ7@ɁdAFQd 9N cɑ("$DI~D*2HN!dQm sd\J.#5Z@%fr;Ee^ ~y"CaYC% ,yrSѝV5lnhI$$3J%LJ&J iv?t"Zɵk7W/W]\=]=\{2\{pi‰fk2Om++whvxt#ҏFjDt 7tK 7afBcYXXbbnNc,lz[Lfh3c]MӒi:&~|3ޟYvVu:!i.o &FQ,azt3᤯ bxZf6;!$5-Q %KNfISRuI l;kQZ"($cϿTh` +ޠ4iz:]JH_F菵{cG 5v=4&f8>,ۗ `tl6/$A}:3g>@ڶ9ݜf>6IOnO Jiv=z 2^]][6?L;vCrB=o3kK8A. d2'/uۊ,u:ztRe٦X/ [ibjпt Sqpj:NuG {o;a͆ͅI]ƽjȼ7{Ftk?u>JSX&EI9IsOn]R旹}#7p |lrǯٙ[_af0U囚ML:XMtE}5_c8OĆ>:Nܿu|6;> bX!&iu2qRo<[ONMM o8ٰq'ebhشcn z{aIN|Дpߜ3^ 3že[h!=1i{`w'ﱚlʉs9sŒ!{CM:gwjlad`4]/SrAf0` 7 6JC, = kA(6eNpr 2.amhώA@c kY$mE# f3|ڱ ڌ-{afǰkS+mff&տlBr]@ݳY}^䎰?<waeE僜-zMlbAuafG Ax}'> I7۾-I(Oi!aTId,;F KtIxB 10\x"%)RҌcqT2BB' ba]:!t] ]uރ's׭\+ U2٪lܵңbK7>^RS([Bs*XC# $72WPԱOIxXuwZ[hAo'f.]9bcᥳW?}-IamwiXbە)Tq@?oXm: jvm89R[ &Yuީni#}##}]K率`/ށFJƇ;iIoiK=׼ԥߋrz+Q5ʭ M(`w~q/ ߺkJnO2/rm#EQL=7x<(-pӣ=k%f`6&kF^0xXsc^4zm2۝7/jhOr/=y@RϧQF:E~w.x/nvga/k.E(jIx1|qk B`@i]MYpʐE( C0]n`L27R̢ td8LXuAd᚛b;ZfZvN+l4[nv>?Níoh\91C UľXQd]3xŖѮop4|r|I_ Cϧnn :9q,'y}[ᕫ{F>Z7+O i~i<`kt<`41W-gbIWسn5'}7[Ȃg|}͋W֦αksiANʂo?b \$uC-j?DZs:4qŘi%v >Qgz$\zY,R?n2C HT[ߖc\零{M﹫|&H/nYc^`xۺS^ctˡz02#e$uPO^zen>I'G$ b)Ar$z ;Z~|߃GM?ˋW_e,#֣GCk;-0ODth5t|YhY~pxG~q7<ڴ&huv1&[^8D=zW~Qx)SzeJy,}c~lu5r]#8 Oycm冮:ٻv䕴OD1Nh,VXoĺjQͱ&ium֜鰍9]σ?7Eyv|u̐ s/CYt71<S OWNL_z \IombŰ5eKD״׶nhh֡}f$V&1&Y.俖c!!!A!!NfgHaH݀< + /b(ʂD   5.@# ?( Эe{uVY&@Lx6GXa1U)}pF^G+OflX-,z<^铛e}[o, Wb܋bxvļ`+.nV նەs_e[D>X^SZcm\ү?V3sVdŗ2Mrg^g?$>kq\Kz_8}ޓm^&{FXĊK>fwaA" ,BTyЏ`bEMȉ1LpVC~P400165H˼4?xGd(,l%!{g(ryw߾fuy΍_O )PzM0tEeokM]:c릒q\vf;/'Ztzkyb҆ L>]fbXb/z'hKmW ,Way϶tjE =xqT#Ò/t9UU~Ζ'Ti\h̳Sܘs?E&K/%l Leo{AE\]6wݷ 8P endstream endobj 261 0 obj [ 228] endobj 262 0 obj <> stream x] xU>zٚ]e} Y % H'i$&0dqYG8"# νUI'`g{{}s=wTU'  @R^IIKfL @sg^Ĕw^lpQe始\ pEysMsu7V`s-,@CYP-^5 - ;ܹU0Xjm.Ƌ֕J p͇XF]MÕS#\"Xgռs? !vXvcҺB;:\זּ}ǧ6) +]醥KllvKv>&6| A@׎[uhEhg`_{g=6k$5`;UhW?qFbbjJ0 _pOZ]T,*9µ*ΠQss6`OK@?MW'5d.#YW`rf7nG2?"+Aӎ ?XdA"޷yp?`H ,<*'r4Za|F/gCz0  1@b(oybI_C8_CD" qW c q8 2K_E}$`ha$bhqp)B}40,cRq02+0xG=,$3|K@= SHDDTHBLC*b!f" 12'A&'#~9aSNɈVȑ>ip9?\Sat `: C P Y0fe6iG0f>Ya6Z0W:% KaB(F\#~eJ@OX Q_+оI@%neWAb5@A$ءq%,G*:Ոq5J4@-Zщx\@PV!j5h9ϛ.][о] Q Z Q??uh#^ WI:ףplF b#nb~x\x3\+N]pt~xno7" ،wMwh :.{g"VԷ ptG< # ~!xD|p#opcp/C-;q_ͰDvxqx GסCA ^] !> q7xQ# lG|G|~/O >$_a/B|_)ė݈`*?" gPE|CyDA:Ϩx^ / {-x0xQ؇6c_>8ޅ #Ix u o ~o"b%ÈO(m)"wP#~"| !~'f 9H{CrY?sz2Z? TvN',h,St qޜ~su)XWr{dؗ]Ӝ^Nw ZiN?_5Њx-1ezs;,r9XNc,r9}#19(G~(9=ӇӔ~zH9}3/g+9#sXNr<%œ^r|%؟bv@N?jN돜(ppimV * !^@[M~\6Y Zx~(6NnKM{IHrS7u̓onK~6YB x%!p= -Ff@IX0_ `Cz@[ R9)̀` QJ$ķ9̀J7C}" !$ $s_7aơr4f@~D3nj~ln! -jP5Bݗ6~E2"Rv܌mf@~&M]{ɷ8t_ H@aZjuBݗ mTBH@|MP%1JC o?RzQJC oI4Sn_ۗ}/}@⿤2}2ʷy( %ctF}gmT /Cp/߾doA!ķ&Bhhp[$6!$ (5 "G|g6TC H@dG@D0پ߲ljDE\̓oC oÆE6 *~ᔿj <ޏN| V?2E[# x,.)%2lT>i".y\MV‚}~\*=\%Wִ7 grG;P)"n.Rm1Mc*;6Q` :*;lR{E4Z::\}SlX7\TO2>+5.GR4IYia4WXcɯq ګV~͔hqFϬqԏmo#D=$ x Cp =,L&6nx8PDnn) Vb%V'" jat6zB7nP+|Bpel~a)[Ҩ_Z3v`>.ĶyK2I)XE,i:iY|Hc֑6^%g.1Jbم{υ{] gMy8>-X ΂ow-m'Y+ce!-d7\O+-v<*=ES(vX?mvϛ{NKؽ|z%痖uz[[ly+uP_7Uu`W`U[}TJ+h_Ҿn}UX+X_$A/n-L/]&s=^=qMFv)Mn)y ofxЪi h*)UmbwG*#RV>zu&|+55T OK>Lx4`q9#>ino&fꊅzji 1xb17}z;_-}ĝ>L>U ǿ..g8~eN0r'mO+8&txO3wN 8Q= sm􌀷`L>Cp t0&c|ITs@!P fA < p$ 0'!|#g5p'< 6A7l0 ‘iT'"Q`LȂB ~ q4'cCf &OۥvX;p !I'\<].sN+pTv>,g~W;N| _~i.# 0G񮝁3ˠ*Z 09St/ k6YU$D㊌%UDI-B~Kr:\_O Äl!Gx_ETǫ;ϟ8ZJvJgp}%a86s 18s\F&;ȟg¹\2J*n9>;gL6))TϪI|UQ0u" 6Wp9,w܁Ox gM95HD2X|n#!a דU\7]Br5\,'\Ѹ#ou0"|?]rpgZ0pP@>Af=/ ' +X&n,["GAK"gr 7Ă.n}ӭzIR5H<z$?,F*Bs93x6g\LA);ȹ7'pn6B,C/80>z߲[Ct˭Q"^[萬nSidѐ*.X^q",<;2aF!S)nz w/8ZF]Z?tőyl(WhW--CPCgiNmRL_x^0ic ro ҫN/tz}6OW/4\u7huA a"7QH VnP-JtjZWo ͺ;uq/ Z++.2XuB$ m\Ai0 ZdHNkp9 /DtZ=CfuSO穉YMԽ\ոdBO<1V Ok~eS B+ @0%Fө1皮Scۏ&$LX0=xڠJps <ױ$.wdOpJh kny>3duzƭԓV|)_\;}MpZؠ 5  YJ5pfsjv^#q:U:Ft}):Š (.bJ"GԔ1Qj]oyջ ~ܝKgJ],YB,x 4Y87f52LS !Qdщd.Ξ7sfvjR(Ūgeg3!ۆ".i|'Yw:~Om&]9~a:}jk+*mJֵ=,7,Y7b>0|L Aq !"E`t.\0]v5KE?t ڵ3.(ӟq]1^*(:݊CRc*Pt5/];g]m?QtLRtETt#US= LJ):O=L :cez9[yE`|&F瀢8]qH: Ndz#].@b&SWt}Tq߃`(:wy?$ZѩvxGշtEiy-]7`Œ{VVZaZwV:6sV:q#ibYp8Р_ZQt(uno}k=i4]UNeJ}{Jg:Zɬ9B䵧33ڪa=2~-8>2?XFYi9Bx,P0Cd+Xvu#3LJeWX(+(ע1GJ^]TjB 5H;{BB T)BC ($@@iҕ);(]DzU@@k"pב˸f}gF ;[$Ǥ%G$Ǥ%G$Ǥ%NMrLZr8$8qrԒ;;NZt)QKZz8jIF-pD-irt9 r%-B.w\jIː˝!eΐ e2rgȅ2hr3Bb r 1Z\ P-C.w\(CH@`@(C!;C.!Fːΐ2h22Q8-C;C&etgD (C!ӝ!e2d3d qZLwL!Nːΐ2D<@(CsuMD)"ͬ3}#N<+Y hQ[V4d<mߤoBmiEV h8Q[(@ B3a\JsSPr%a5'50Ws5'NV0Zsݚ\9qʃTS'0lF\ͩs 5FY3֜:9+d5Ctͩ 5&_3\s͐as3Pl@6C͉ ,!9r ~`31 l - {~ lFd^fg$l@!i3τ B͈mFjn$o3܌ I,b s\D`ҞE" fH9w3.'$ z3"^3`oz%`у3ߌ8=@"v +- a w/#`8$^2eP"Hp'uN,)(!ΐ33qI\R3\48x|E<qFq<4> RB3$gHɭf'o%0r:/gO 38qʀrsFa ѹKsX`s @gXЉ! 9y8DgHi.*8@:CDbf` a՘N3W;#Qg.-P!Uw,̅ǹ֙ _RB:_g.|iH5;C.ˮ-^oJ!e/n)yCĒL7%.;3qި XRľ !w,dIAx<:PO2HzĞPO͚vY&yb aWfq|9yF<SB&yE#WA`c'^pya89yeJ01O`c'8~xryax9yis+y`:R89y'q9y'q‡s.ەB.&X"o䨒8rND;ǯ]X`^ܮ-G0/'3n#"zEB\!D=<sσHط* .W+s'3 gȕWԠ>gvv, { vt_bR $& @wX$@wow$kwaiqHMM R+I#]fo4`xnk#BpE ֵ71d Kk@n5&~՘1 o^&]wjL л@n5&..4@ .'.N+p7 weR]&@ $.m xjL6@oJ⥩^ {bc{Vc^9u f{Vc:/S^Q՘!aME=5_x'u_ƛ8(_ǛzAo5&y՘y1Hď H^H0%jB8a A */$Nu%`y!qȫ/A$Ny&H A 4/Nu 6/NuE&ypˆWBkV/P8aDBW F=ł FV@BQ`/,^eu4J/3x/^dF8 (žh8aԫ}za^Eg4q~P +^|Fkh@Zo1z11$y՘!aĐ '.uSt^'8,':2N0^p¨g p{ a…F.0bmM'@ \L${jL}͐0z]Wy gQ^Y |jL]bjL"|ER`՘!a_`'7 P|X,@V|[ X8O̦i/$T4D īP /$q-A%|M,F@S&a,_b7 52 D\4_bwoT/%pn /q=BPK\@O^_/X`K\@O]D$_mK u)Yp|W& /6K /6ԃ_m*%^نX*%^ن8^ 8nlC lC[K q#A%^ن^mC& v/6i) t/6D ='NJI{WW^dK%ސ+Z\KZ\KD(^"ĕ$D`/78I{vﳽlee!W #{vo뷣\o~ R/JJ 9nc/`PzWY^yE _/Tlz!W }eo >D>/$7Q/ ڔqIKd8$%yAu RA+yus `yX^Pl>C4.ϐ+3 { /+"Hx<^aGK /+x0^"WXD R $^"wo I՘nK$NH $^"bx$jL|A%xITK$Vco|21B `.xE]sR+%HH5)H(rO$^ulF /[&L@z.kWwi~@kW~ Mafs l(v?خ0e֮;VԮ0UҮUЮ0{Uήp<6=ήpoNOF3zHjE^iqD99k1ΛuOc ٷٷUp\좑HegjF:Zqĭ ߞbYyWKlyJԉ٣g|@PD]M"#bt[3q߉S?(t$an~?n0.|gώT-6evԻkjEA[ վ<<ǦQ-;/MNөbB럭ZuzXTYN(_JO#vjmVQgOܝmﶵ YmUnłA}CW805KP'"ɝZW5cIZ]_O?޺|蔗+9P\j6E ck8eF<#)z7zx'M7 Hȸ%}wuqω&^kٶ}0ѣ g̶τQVv f'T""e>5X|',[}V^^nZ rG\n@]X\pOyg[q_swwֻ73ϝM~hUTnܐ!ΆlY;\0dޤF?;r*&ƜW3yvKݫV^m0]ϿZ1$YIG[q]F/;2QϪ'mMe.$"]& >Ӿ~)+Ҿyec#W8C hjհ7x=jJJ\jK? =PC=љGxF8ny>z_'FNwv#ofk뿣ȑxx1{@CV?Mfu+}Q7➑-9(:KبLڡ͡mƿoMʋ%'p4f#w&>z֖V1".3uE6fUoŖ}?giͮ>F(Y&c|$Yܕ|n:v7_䷷Cσ[pӆM4P/.}q5'&^nޕXgd.NYIJ~}n2Ovrx!꧳v†9/9~QpD@^77|=Ġȑ;b/=Xq>4>sM^_7ygpaX=:4x"K#פ:;*rYɶDm ,a˷}{<ͧ;Tx[W~xyj<䭚KZUoߩ˦i]4$ ?绗;kCȫ5r_=#6SlXyĵk?]:uʝvW 3:겄α"o4޿0GKy\O^jswy}hdqj Zy)mpUⷔ ~gF缝B=dMӲI±-'A_Hz/#B}Xk\b-'{ >\)(Zһ??Ս99[U*W +E;2ʱq1]E\' Z%!+qH5Ჿ68E~x'/z̙SP_Zeضriˣ7:sݾ.~2Zgygj}RAjt`WD.5u̇16vㆋykst(ys V*txHW&iiԳ2oA聴e3_߾T{gD _lݓϞdʾAGVؾԯQ^?ھ`۟:?gBg?)yu5nUf _{|5mFؽM ^6\o"Ofm4:%so4z#K#is+kv(E׉-.nVzb])J?S/^Dx}}ʤ^Pw5n|p}+&SpX6Ժ~W. fcҵj% ΕơmŝvTfҙį".Ljo 6jZ%F\v]]F۫u\z~HV/D7糍)ߛszm7b21_pn̒׎.<-G{}<3iҹz!>R w=j_JG.6]pCr<55˄u۝휗&MZsڗr;)7ϸjpo?=}c#:{g=h?A3ҬXh*ODݨΕLS|U,Q/z &Ǘ]pGȞ&3>7ޟ[=ʤzq)-E<(v>ٰiA-ʏ:6j Gt91_GAf}U1`y۟nznrNWjkqP/϶kEeʚjy{>ĕNO̽4Se^|z]3q3o8go{ViܤV-igiɵ/],}l;;;;*gl5($יmH}76L;齓i}:οo~tF?_v 9ԠF_ߔi=nA'tPذ% }a+46Ny?Nz-)bo3brQBkCʌo=wԟ>7 HG=s,[ًeu;9883O:Mr67s&1!cmf66 Q9ajϗ.ػaU1#?Z}KlcslqBfMfދNj4d fj~vF> 0xz6o |F7 NWrJ|ܡ0CM0#tv%8G#8j.0:Ryb#slρؼ=A3o],R&?,uu_K׻7GO2`A\}?v ~[G_,ͮ,|搜Zk#-ORfY,[>D_;xJUj}n+ʥvPEE-n3+Okz򃽯^u#lwtȪ,Vo{bؚMTݟ}:nZ~4KDeF-/t9gѓNAd崝[Soԙ_|QwF]6{,[ endstream endobj 263 0 obj <> stream x]Mj0 >d2J:,CFq}e7L>,=01ac0I8oѕ.&*- kN.x+;dO3>Aaj[p8ɠg_̂ v>ga{D c5lhFTR-4ORBr'e8{q_Z{n,yJCT>?oA endstream endobj 264 0 obj <> stream x| `SEIiMP(KBi@]( дIi mJ"PqAIRW\PA (ܮ }{?gf̜s̙I 0@6nԈsq}^L޸BV-` {\lWb̂jZ1֋T@%\ؗ?VO8fui&{5Oo'6cni_UcEe9%!Wf Id~#?b_QȟPmzUV阣l`]4ZbƄ{$A*Ms$X,CTiyV0VXfp  d1Û©~?JBa= ^3 ^rV"Ǭ'' WH嫗$-Qщ2P8$/d0Q:h(a(p,#%b@@gv F0Q,#_A͢0Vb`9Co1֭v' ޅtz]1KąAuoD)H}(_D!A@A D%#B7%b0"@W`D !\! Ԉ0D ~8^AK}b$D ޮ1A(D !ƂQQv]8AXw]`@L8ā#$AA0q0$ &@yC! q B4`9Ɉ)Sab u0 1#`8HHq5(HE GC:pL#8nB̅ш`;ȃL񐅘و u `,b!"Nq un8#N|ĩ0-A a"b Lr3܌hɈ4XSˡL0g@ b%:V(Ei3 宯X3g!~qT!+%p R nEns}q9":ĕu W"հ.OnXx,E!AA=XJNć`#xV#>w!7=Qq#Ak\p?fxq C܊x!'a}/Ozĝ ރ])؄s Ofga su`xEz^B|D|zv! O!]a<:7B<[-8/"߆]ox ^Ax^ERo/OX$d D1Ԃ gHjSM84|f*VF\N 9X:d9 6TqNad2;#s 4ZهBl M-hTNAU&gvr\rrBN\_'b!$j s a΄|A,^K愀] Jv>ԡ 2hod.8'DAO m-j.jyE5\=W[ G =y`l.oTm ./o,&E.F:@>h$>h>7N"$ih7oip5h[جwSn!T[i49a9+~E tRlɚaeyN蜉XC]TƑN@&K/1Oxidە,EM"my,4 |;:;bӃ9_97mj5 Qt-W)m6ꍣtrM{948;8?ؒ6Mi. "W\r UuU KH#7iĂ2mz뀨8lDǶ3DGקMf-2VOքJǠ>j&M^vBRJNٽW_!}B OodMФ lMn8{=IƓ|g;<}ٷu>'̷$7#uθ` "w'›RNwwrT%k'`\Aņt?,]x/ǎN}@F60]V`jOtTwbθ8aPq.:ɹQ T'(Jx4NiPJ6V 1}|#d#=L?oίַ/,ܗ cRO/oC"Rߗ~.?v=+P1=|=B} 0G֋F2Q#{'J%%Ɋdddq2 ɻrb4Kq3׍n`\gn3gR.Ke 7e |(R'N*h`BHb0_xe!ZR2W5>s00)y;b"\N3Y= qXݣбN6E1RieUO5vݹ;n)L-Pp+vE{5^6$M%ə bf0#զO Z%Rt|e-O˯NqG~Ky)!IQ_"};!}%z SxVv| Z IL;/<==axkBp=N~RG`I#Wxkd򡀙08~5<@7a~FbJތ2,fFo NX k4T@j#ۙÌ!U& /nCk1`ˠLF'A:&4X$kaM̨4dky XY L(|!~ H!sB/Ci;:&X/4>܎ Vo z6 l6ud:_Ч q!f=SIʞjic<11ѩL{ɜ 9OzԘT"rJAxC$ XysެJ,X:k (r~;;Yc g6}ф'>R[WH>y<ޠgPɌV"x[ZP;$**jQt.%\rCJA>߳8UKq3FsR/A^ʰ[Cò¦aa#A#FzzUl*V2XPT*Vj0",ajJI0oZU*Z zGtN$mP&䄬Q?A V X5L)ՊZ؏UlP?Sd䂦 &L\?6ʦfը_ͨC%9<B/o kll(8J\c\4S7un&?5DȎNwtrpӕ'l .]}Ke:UO&)M† /~ORtxxt>ܯÆ.R %boffSޗ@fM( gօo.p'j86 >R#nVRt5˰o(vJc4I:&D:EfSjݶ.beG| r_j>jPDg;#3|ᑉ)1#v\]7jLGz^7b!Dq \!r=bEO%An'9:੣qWӊO3nZ r<Ǹi 'B2!dRZL˓(A)-xJ60f@xAO X`i1,iA%'Ӟ9O{ALސ i)T> >aE9oQګr6径&?CZFtk(폴BK6Jj+7ئ<Nig6-EeL/#!Ҽ9(r?Z^+O4{|:kI GuԷkGƿmdqXC4&VvP+J*t,B)cRWS4sK=[ː&g1ma6":RTy&%d io&>ʲ eq. bZ%l9J+Y$;JlvpkWrPVFFy4*~;Eb+2}Tp{a #b72Y_5-1jymJ6ZH4 uR뢐 gQ>g=O,f#:Lwr^2]崜 _)j%{}Yymi;侀Q̼g)F @ܷO=|8zшIJ3N@oMwk5]hݼ5w 1ķE=/5|_niђH1^1wb6VX:b%RAf*bjaPkܭc]G:;meĥo31ѣzJ /&P^c[tiw5v'PK[N]jf;gS m^m㝥]\G|p[DQ`Y9_6F_涕_eMT泇6~l-.RxVf>X3_N%oimZy*1U xQVڪyltN&){liNk4UZ.[[L_|n+-y-L=ʩnM2Qïum;#Ҩ%f8v)W&}r`AVF-SrHw{{sԖH8NnhE->{ӧ0A8Z8B81 M|l G\_r*`\.M |sĞ\!ذ0,1bF H3Bf@#ܐG)Qo UC2cJ.=׾?,ߩzF=潶aaKrGd7baɟmI>K=b^[iU\,VtC^I}:֖nTY]^5g*/pV_eescF O5fT^!7<55='/=-,4k?>,'i~!NO }A?0.~@Ҁ[غh;uu~ wl~TtLz-}&|:=uϬ)=rL5^ZƥZ Wyk>Q0eJtN{?YѢtMg~MЌ%7 I Xt.\Co6ΞM:v{#vq-s1DzLv?{Ɛ/oAߔ[aqi&zS;#wݟ^2rj=w._y8{ю^  dy7[~aߕԯ':1l\\b{'Nhq y]#w ',J;nLᨶ={v,ll1%X[7#Hc?ϵ/dzvㅌ``!@<–t/jSذ|ܽ( o[\:16{-wNy76d]?>-wi>:uk JOyo;s^kZ+SxiP.~G<ԫg*ժdr|Շ^5lI7"_+B㎌A~px̋y)Yny;rv/[)8v(¹駆l+z%ٞ}a= _폆-\.}!S*<'f~sċCZ5@Ҧ}3zX]$@DzfI/2)8'{uI!%vQc{E4Br!z2EKF2K.3ص>c^"RWsV&~B!+7v/fEs/w4mڦU>frqCKԫ/*y{$}z=ѥ֕~Ƞ=g zkhڨmI[ώ="oڱpEѳǜyiu9jWmޥ >5e}Kr^O}GAgzʖyzFj`/Vx$&Xd{u=;xJ`l᧗^yvUn ݜK%zw_%Hm$M:R}vmOezQ? Y2kN{7x_dzo.[[CEw-[up)ͅzfÈ%_U9_nX9dū?O䲿+eѯXUGl%Oʋ;R<, ʹ>c/cݧ3x.뱦oh=X{}zO>?0˨y>F*\?P'};[s{hڏNeݚY{[iDfB$S⾶UP!0wb ț|qgʡ7Ԟù^瞼龢JGR|߮ca:swfnZzkvqy~{`ԝPw(;Otk5hǿڥVk>?X4 ?}Q4hDL %+OBbQ()[\զ87J`Wҷbq;Je|ʢÊ9˿ {BF`C* ڣG? +rw 2*"h_`L8]"}Qß| h 9~T42#Mj94"+.`?٨AF-$Wf)ɖ6ek38!{ ;\%V9DvTmHn.%ҠCG2ֻ~bOxcχWk$^zEJЅ {|z 2&V1Ӓ<ވTrڕWagelc6<{]p-gs /KiG˕:%jeG`n|,2?k9}D )\Y;΢-/k6[+ٗ`5EoX0DQA(v9T{4<rG\k/8gv? !/4 _,;=7peibu䡕tΧjf+怋y<8ѷ9hlI@!beECPuv! N C5]H'4;6VFYL/1rNZϿ{K«:Bz7on_=.Q6jzܶyj5㘣9isF> aV~ >^$$Ҭ$l 6BKSsD'q+V=Gkъ,mN!KEU/31dxO@F|K ++& "v`q^ * qi8E)I4uJd$;q+"b٥̴lw~D)yDI[=L, 2aчO^MfF9u ‰䳐2N>BQ@"ޒ*("T`L< CLԮ?ַuΒ Lbya&CfLi T\r^h^ y{\4xƿj endstream endobj 265 0 obj [ 0[ 1000] 3[ 193] 196[ 352] ] endobj 266 0 obj [ 193] endobj 267 0 obj [ 245] endobj 268 0 obj <> stream x| @TUy 603 EeXEԑMTT,FfMfp-44MK[\srH˥T*M-]2M2|A~ss=OhRfsG @ ߙݰpⲇFF:ځSWprS庪QtԐ &1: &󇋪Ɩ;rqX ǛƖM.WН1{'=9agNCD+ (FR7aSqiRPZq JDǗU>ls\7sXV gN<%QTUM\ |e|yU5K_ffOsQ#Ҥ_PDӦC].˸Nu&O{⢝$-%4pnAgI`(a,}0yBp'1`'u+ E;',cl Z`a`OTp:NAݰܴcR$#[}Z-A'ly\;/n:qh_\?\]A(!n@ H@(r<@;x< ^o 7~JC &Fp%+t`U"v`ȦB_ B ] ЕD@7HP#GaHGA8AwBx !1b{B*$AwzAE}C2#d@ HĒ4āYqG&0 Lġ01K0 !l}y01 /C8!> (s<8,S/ _W"ĕ V3a Oa-,,9 9`9w6Ho_O`3Wak9[?3BV#kr6x7`oz 9;aһ0Em،*!F0# .lE!xD<@ l!؁Dv!8hv#~ { E<G}g.1x8 xK8탯 CH  ~"[8̽ '߃SЄx>ށ31YKQ.H_cȹǹ=|?"%Or nA":ކ)_4 8+ނsy[pEf6\v#a@ӴZ oG7ôGglqD"wbZvw/jَr⿮iMTT "Q{wnM2kZSrwh_jz[hG7yzzC{IfN٭vwB@m%TooviXb\vw/ơ^n},x`W*ơ^n},h=o D8K٭M,˂sZ{Iiz[l=o n٭FpvviPk/gm$nݺk:{Ie*'%{SDDJ6:,Þ7EGGDƦn/unaznnR○iMفrM.kcS[v,V]e ] YJ6, :9tH^Jv\Rm)yJ32 бz,J ' 9y;LGg`r'xzY/% ^ 9c_jͷYJצ4Gt_>MagiDL =\k1{yV%7qvp~%i(R_Pʋ\L+ejlZi* aVJ3 *rw`oX_ƋӣP)'Ŭ%%s#juK0oƗ[Cf;DzGZ2䥥*f:%e_e3sZؔ/֩(s*s PkYtcU>Wلt*>]Ŧvp3ƨXA"J+`ʧkҜ>/,+(qyKi(;:ZZTQG|.g2NCUHchsBQ0 PtEMvTwRI;ARL.qvq$xVOt1'b75J#HHOJ98RJE2ZI:)d>n"/nII:%uLb:$)|II$$qIЉʉl94CLsΨz*fz wќ4>j=|{Pbu4˲rH5+˺ }.T=GL4bFĪ(ڷwjTbYfl􀌘Lj3J5(!?#663%c=+@VP>rȩn!CMg04URJ9(Bэ(әea`N])θ=OAXOƋ:U=9Qӵm O\\J8]D C%^Q?yPhXݛۙ=t(<_ zM701 Vl`>]Κ>^'8]PٳLm?W'ډq%JQnsL,hERO&A&n-e܂~L:v65ʎM+}.MH4# )bZYXGӒEO&e.RkCoq۽;#VsbbH bX߸v]ھ.|H"2S Gq[>6)pM@3,ȦpLŸhG(,SHȯI#S΄vN!3Z@SAh#@(QE6u>)bѿ #|8 D .Gz& Zh7I:sZA/Hh}]y]䙄yZ>2^8B{"!Lh/ b7 m#mZIƲhS'ȆD/#t8󴓍N6KlAԒ%)=יtlae꒱&64N[*4٨oYK*jP=&R_YQ-1:TuʢX\RX̖&c PbTj5%F}IS0;0LW=Pm:ltDR эuPO` L 4JMP0ՠg3 nf/;]fH )؃'_oB!T#TZ?J$#_-X<*T%֨VUXo2! C/E e*hң 4s!8ɘn ҖDFcr8U_v"rJPb&s iK9j"ZU9,R!:o_^#vLwi˝ Cx5h/^d-iՎo0 l$7t6rYt" OCPD"\w.H`Ѳ($2[$W2UդJ}Q"b{BVaA],b+~9laY5dvWvM,Z`cҖߑbrR"!/[X@xcI/\YohX>uf,cbF2 @Gzg.$&Q9-#;f`vГQg^350 BХNw,RHp^I"zɽcYIHAO&;}ÑȸFycyˬ^+U,c o8x=fu[A<sw#^x{a-mM>tUꥂZJx,vdL$1̳Z*ή,Gnq+XqLUo^JSx;P*{>߶XS0V+߽mE &m+]V.,RYgѷXٺɢG6 /!_CB:wX5X’W(b8Żzkwkg;:]U$fFԘ-y)&+[.E+C$NJl)K:V 1߭!hָEAdMʌ zPǼ5Sj a(5Eל{Wo$q LydjHkKwVڎs|2EJޔF=Lbjaɭgٽm:Nj!iHpFD 6wvnM+]$iUC"^Xg B5ٽ-;)+#[s'*-iy˰m9wXm%?﵅NG b6P:]na ^u۴fS[lH+EYV0+ VL,SrGȭ'z[9DI6:|`k4Cȧ (Qb֑HkT8ηoh!Hm?=Y>/;w{Qʙʡ)*]#;YJh]bJD͌)!M '`uDlTEy_u"وc>Izlix=rۚ4в~GxyhZ?{Ծ 3D. %CKV5F;`XY=.G+z[+Qan՝%vIW^UR1jPRh`TVb5іA3rپ))i9ialhaׄ8>n qQFib5Q F+P0Oҵi{Ѱڀ]F|5􋚳b Q/-,rΦ748;dIW4w+y/5|0c"rc3e Sώ_6-'{tۺpt[4}K0(n{yL˞xQߥsi;Vw8O>3 ݕkoʉu]Q5Sݦ|tpGcyIh/7m<:󂏶n ]orYvMn^_|fٳ6;,/,њ̸ MѴiJCcgלrщg[;q'^i\Ԭ&R!:P]n?!1X-6'N8Vx(~30sH}:=|APNĒnijL^/,5;4ohb'05O IeHIg1jqR=q&'YQ/ ?ϮOFaךnPk4g{ I4.&ƕgJE"7ډ׳ |tV[[t\t -eWwڛE<]?w^;bCw[K7%ՍgHL08knټC{}G9uFyKRnRx&%͑}Ǔڻ@UZղ: kKURX]i,2)UQ4ʊ%:o#Q SGo4Yؚ48aUGkc}Fz;Uz^ ]줇5߯8?䑛 \ޏ^$'y¡ܯ V*ںܔ1IJE-ݷ7h>I +y#;]z/ njǓΒlnGWOxi6}9QNVlB  +ug{}fk맔m=94F,,({+1i87"uGkfχk'Kn__Po_uZQU\wh+;ѳH7hj_Ԯ潟.>;C6ꓪ+%/Oz=)U g9\kvD Wao,8x!X+|~gϑ{TM:DZ܀߂W\"%ڱyc/F9 \?X 3N1Fᛃ#~2d6&ԃ[xӂi;J\ع)6L<;a%|R督=OнTYzD6 peOIo G5+]Q AFv/7?40,[7QQxd5\I=aC<5r>2Bg,=ׄ43NŽ'N|mޗ{GUi BxK>_|rgdC=1+r;E]SSu{WT2%,dB+=xWogi%~s).q*|]65N{w n{"~B,[#?iOӪV/?v/ EmX/ӭ';}f_~5wj6={C" XwHaƕ. R0A,а)4@3~kи1•qFj^_m}kzU[,𶏌;?R)w8~~zi{ 8nt5Ň?k|t$2%ı@[//ض>Nmӎ Mƕ yeƅ|rgaɒ(/1^ ʳ88/]`f % 3AE)%-@"Tpȟw>|˭Nzg\0l&wŽ";pziY Xl.g_޿5LzԉZ||_ІGij;#v[$w~zϽOGj 3n~"QÝqӛ:s^9CyO%8fJ?(!$->}W~_V~B}{i3~7vKs9fjyVOWۗk|'n7lbL./=T >evAxh Nդd6A"#T b("eɹM?oN{6`P0 iE^ )bȤ e^ `c^_Tdibd?aamN)| Tg<[%m9WK~G{&]$v nzFS?O~ *>eC2q/lUr y(?/`y'$ʚό.Ԟ%Xϥ>% \[,h_3%&yV}X88':Ȯ; K\Gmu endstream endobj 269 0 obj <>] >> endobj 270 0 obj <<20C1BF95CDBE0E46933CD605654E1D59>] /Filter/FlateDecode/Length 666>> stream x5[PawwmjwDcCmgIG֮N:8! 9T2c8_6" 04t0f }y/ϼ>3okd仇SPXĢ0$}-Q$U!R#ҜMbq`+KDLYOD#rEn>4<T2̀_()ZY[ HE3Qoz o0d90,*߉X_cꈳ:lJrds޿c %2F'ubsBdf_' M2BVA0`!08 aL0fBL0 f\< a$@"$A2@*A:, X r  ABJ Pr( *PPVjXa-hͰ 6F[a'&Z`= {CpQhc}F\ҿEGbULkJtq .'1vrO(,]#+d{^ ]oTMm"⼘ b uԫw{?ŷ b OV e endstream endobj xref 0 271 0000000089 65535 f 0000000017 00000 n 0000000144 00000 n 0000000200 00000 n 0000000865 00000 n 0000012287 00000 n 0000012340 00000 n 0000012476 00000 n 0000012504 00000 n 0000012668 00000 n 0000012741 00000 n 0000012987 00000 n 0000013162 00000 n 0000013408 00000 n 0000013546 00000 n 0000013576 00000 n 0000013742 00000 n 0000013816 00000 n 0000014062 00000 n 0000014195 00000 n 0000014225 00000 n 0000014386 00000 n 0000014460 00000 n 0000014701 00000 n 0000014871 00000 n 0000015112 00000 n 0000015245 00000 n 0000015275 00000 n 0000015436 00000 n 0000015510 00000 n 0000015751 00000 n 0000015921 00000 n 0000016162 00000 n 0000016302 00000 n 0000016332 00000 n 0000016500 00000 n 0000016574 00000 n 0000016824 00000 n 0000016964 00000 n 0000016994 00000 n 0000017162 00000 n 0000017236 00000 n 0000017486 00000 n 0000017664 00000 n 0000017914 00000 n 0000018102 00000 n 0000018359 00000 n 0000018545 00000 n 0000018800 00000 n 0000018947 00000 n 0000018977 00000 n 0000019152 00000 n 0000019226 00000 n 0000019481 00000 n 0000019659 00000 n 0000019918 00000 n 0000020077 00000 n 0000020253 00000 n 0000020499 00000 n 0000020683 00000 n 0000020939 00000 n 0000021115 00000 n 0000021287 00000 n 0000021470 00000 n 0000021733 00000 n 0000021920 00000 n 0000022177 00000 n 0000022326 00000 n 0000022356 00000 n 0000022533 00000 n 0000022607 00000 n 0000022864 00000 n 0000023013 00000 n 0000023043 00000 n 0000023220 00000 n 0000023294 00000 n 0000023551 00000 n 0000023726 00000 n 0000023971 00000 n 0000053905 00000 n 0000059345 00000 n 0000067076 00000 n 0000081189 00000 n 0000091764 00000 n 0000099506 00000 n 0000111493 00000 n 0000120568 00000 n 0000142126 00000 n 0000151531 00000 n 0000000090 65535 f 0000000091 65535 f 0000000092 65535 f 0000000093 65535 f 0000000094 65535 f 0000000095 65535 f 0000000096 65535 f 0000000097 65535 f 0000000098 65535 f 0000000099 65535 f 0000000100 65535 f 0000000101 65535 f 0000000102 65535 f 0000000103 65535 f 0000000104 65535 f 0000000105 65535 f 0000000106 65535 f 0000000107 65535 f 0000000108 65535 f 0000000109 65535 f 0000000110 65535 f 0000000111 65535 f 0000000112 65535 f 0000000113 65535 f 0000000114 65535 f 0000000115 65535 f 0000000116 65535 f 0000000117 65535 f 0000000118 65535 f 0000000119 65535 f 0000000120 65535 f 0000000121 65535 f 0000000122 65535 f 0000000123 65535 f 0000000124 65535 f 0000000125 65535 f 0000000126 65535 f 0000000127 65535 f 0000000128 65535 f 0000000129 65535 f 0000000130 65535 f 0000000131 65535 f 0000000132 65535 f 0000000133 65535 f 0000000134 65535 f 0000000135 65535 f 0000000136 65535 f 0000000137 65535 f 0000000138 65535 f 0000000139 65535 f 0000000140 65535 f 0000000141 65535 f 0000000142 65535 f 0000000143 65535 f 0000000144 65535 f 0000000145 65535 f 0000000146 65535 f 0000000147 65535 f 0000000148 65535 f 0000000149 65535 f 0000000150 65535 f 0000000151 65535 f 0000000152 65535 f 0000000153 65535 f 0000000154 65535 f 0000000155 65535 f 0000000156 65535 f 0000000157 65535 f 0000000158 65535 f 0000000159 65535 f 0000000160 65535 f 0000000161 65535 f 0000000162 65535 f 0000000163 65535 f 0000000164 65535 f 0000000165 65535 f 0000000166 65535 f 0000000167 65535 f 0000000168 65535 f 0000000169 65535 f 0000000170 65535 f 0000000171 65535 f 0000000172 65535 f 0000000173 65535 f 0000000174 65535 f 0000000175 65535 f 0000000176 65535 f 0000000177 65535 f 0000000178 65535 f 0000000179 65535 f 0000000180 65535 f 0000000181 65535 f 0000000182 65535 f 0000000183 65535 f 0000000184 65535 f 0000000185 65535 f 0000000186 65535 f 0000000187 65535 f 0000000188 65535 f 0000000189 65535 f 0000000190 65535 f 0000000191 65535 f 0000000192 65535 f 0000000193 65535 f 0000000194 65535 f 0000000195 65535 f 0000000196 65535 f 0000000197 65535 f 0000000198 65535 f 0000000199 65535 f 0000000200 65535 f 0000000201 65535 f 0000000202 65535 f 0000000203 65535 f 0000000204 65535 f 0000000205 65535 f 0000000206 65535 f 0000000207 65535 f 0000000208 65535 f 0000000209 65535 f 0000000210 65535 f 0000000211 65535 f 0000000212 65535 f 0000000213 65535 f 0000000214 65535 f 0000000215 65535 f 0000000216 65535 f 0000000217 65535 f 0000000218 65535 f 0000000219 65535 f 0000000220 65535 f 0000000221 65535 f 0000000222 65535 f 0000000223 65535 f 0000000224 65535 f 0000000225 65535 f 0000000000 65535 f 0000153804 00000 n 0000154411 00000 n 0000243817 00000 n 0000244369 00000 n 0000244425 00000 n 0000244964 00000 n 0000332290 00000 n 0000332766 00000 n 0000332794 00000 n 0000333512 00000 n 0000432185 00000 n 0000432946 00000 n 0000433002 00000 n 0000433608 00000 n 0000527282 00000 n 0000527855 00000 n 0000527883 00000 n 0000528290 00000 n 0000608744 00000 n 0000609004 00000 n 0000609379 00000 n 0000688457 00000 n 0000688652 00000 n 0000688680 00000 n 0000689093 00000 n 0000710089 00000 n 0000710375 00000 n 0000710815 00000 n 0000711115 00000 n 0000726655 00000 n 0000726942 00000 n 0000727211 00000 n 0000727239 00000 n 0000746749 00000 n 0000746777 00000 n 0000816594 00000 n 0000816622 00000 n 0000836557 00000 n 0000836857 00000 n 0000848596 00000 n 0000848650 00000 n 0000848678 00000 n 0000848706 00000 n 0000860021 00000 n 0000860072 00000 n trailer <<20C1BF95CDBE0E46933CD605654E1D59>] >> startxref 860941 %%EOF xref 0 0 trailer <<20C1BF95CDBE0E46933CD605654E1D59>] /Prev 860941/XRefStm 860072>> startxref 866521 %%EOF